NCBI CCDS banner
PubMed Entrez Gene BLAST OMIM
  

CCDS
Home
FTP
Process
Releases & Statistics

Collaborators
EBI
HGNC
MGI
NCBI

Contact Us
email CCDS

Genome Displays

Ensembl
NCBI
UCSC
VEGA

Related Resources
Gene
HomoloGene
MANE
RefSeq


Report for CCDS55261.1 (current version)

CCDS Status Species Chrom. Gene CCDS Release NCBI Annotation Release Ensembl Annotation Release Links
55261.1 Public Homo sapiens 8 TRIQK 24 110 108 CCDS HistoryNCBI Gene:286144Re-query CCDS DB by CCDS ID:55261.1See the combined annotation on chromosome 8 in Sequence Viewer

Public since: CCDS release 8, NCBI annotation release 37.2, Ensembl annotation release 62

Review status: Reviewed (by RefSeq and Havana)

Sequence IDs included in CCDS 55261.1

Original Current Source Nucleotide ID Protein ID MANE Status in CCDS Seq. Status Links
Original member Current member EBI ENST00000378861.9 ENSP00000368138.5 Accepted alive Link to Ensembl Transcript Viewer:ENST00000378861.9Link to Ensembl Protein Viewer:ENSP00000368138.5Re-query CCDS DB by Nucleotide ID:ENST00000378861Re-query CCDS DB by Protein ID:ENSP00000368138
Original member Current member EBI ENST00000520430.5 ENSP00000428822.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000520430.5Link to Ensembl Protein Viewer:ENSP00000428822.1Re-query CCDS DB by Nucleotide ID:ENST00000520430Re-query CCDS DB by Protein ID:ENSP00000428822
Original member Current member EBI ENST00000519969.5 ENSP00000429381.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000519969.5Link to Ensembl Protein Viewer:ENSP00000429381.1Re-query CCDS DB by Nucleotide ID:ENST00000519969Re-query CCDS DB by Protein ID:ENSP00000429381
Original member Current member EBI ENST00000521988.6 ENSP00000429517.1 MANE Select Accepted alive Link to Ensembl Transcript Viewer:ENST00000521988.6Link to Ensembl Protein Viewer:ENSP00000429517.1Re-query CCDS DB by Nucleotide ID:ENST00000521988Re-query CCDS DB by Protein ID:ENSP00000429517
Original member Current member EBI ENST00000524107.5 ENSP00000429742.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000524107.5Link to Ensembl Protein Viewer:ENSP00000429742.1Re-query CCDS DB by Nucleotide ID:ENST00000524107Re-query CCDS DB by Protein ID:ENSP00000429742
Original member Current member EBI ENST00000520686.5 ENSP00000429822.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000520686.5Link to Ensembl Protein Viewer:ENSP00000429822.1Re-query CCDS DB by Nucleotide ID:ENST00000520686Re-query CCDS DB by Protein ID:ENSP00000429822
Original member Current member EBI ENST00000518748.5 ENSP00000430837.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000518748.5Link to Ensembl Protein Viewer:ENSP00000430837.1Re-query CCDS DB by Nucleotide ID:ENST00000518748Re-query CCDS DB by Protein ID:ENSP00000430837
Original member Current member EBI ENST00000521617.5 ENSP00000430992.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000521617.5Link to Ensembl Protein Viewer:ENSP00000430992.1Re-query CCDS DB by Nucleotide ID:ENST00000521617Re-query CCDS DB by Protein ID:ENSP00000430992
Original member Current member EBI ENST00000537541.1 ENSP00000442030.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000537541.1Link to Ensembl Protein Viewer:ENSP00000442030.1Re-query CCDS DB by Nucleotide ID:ENST00000537541Re-query CCDS DB by Protein ID:ENSP00000442030
Original member Current member NCBI NM_001171795.2 NP_001165266.1 Accepted alive Link to Nucleotide Sequence:NM_001171795.2Link to Protein Sequence:NP_001165266.1Re-query CCDS DB by Nucleotide ID:NM_001171795Re-query CCDS DB by Protein ID:NP_001165266Link to BLAST:NP_001165266.1
Original member Current member NCBI NM_001171796.2 NP_001165267.1 Accepted alive Link to Nucleotide Sequence:NM_001171796.2Link to Protein Sequence:NP_001165267.1Re-query CCDS DB by Nucleotide ID:NM_001171796Re-query CCDS DB by Protein ID:NP_001165267Link to BLAST:NP_001165267.1
Original member Current member NCBI NM_001171797.2 NP_001165268.1 MANE Select Accepted alive Link to Nucleotide Sequence:NM_001171797.2Link to Protein Sequence:NP_001165268.1Re-query CCDS DB by Nucleotide ID:NM_001171797Re-query CCDS DB by Protein ID:NP_001165268Link to BLAST:NP_001165268.1
Original member Current member NCBI NM_001171798.2 NP_001165269.1 Accepted alive Link to Nucleotide Sequence:NM_001171798.2Link to Protein Sequence:NP_001165269.1Re-query CCDS DB by Nucleotide ID:NM_001171798Re-query CCDS DB by Protein ID:NP_001165269Link to BLAST:NP_001165269.1
Original member Current member NCBI NM_001171799.2 NP_001165270.1 Accepted alive Link to Nucleotide Sequence:NM_001171799.2Link to Protein Sequence:NP_001165270.1Re-query CCDS DB by Nucleotide ID:NM_001171799Re-query CCDS DB by Protein ID:NP_001165270Link to BLAST:NP_001165270.1
Original member Current member NCBI NM_001191035.2 NP_001177964.1 Accepted alive Link to Nucleotide Sequence:NM_001191035.2Link to Protein Sequence:NP_001177964.1Re-query CCDS DB by Nucleotide ID:NM_001191035Re-query CCDS DB by Protein ID:NP_001177964Link to BLAST:NP_001177964.1
Original member Current member NCBI NM_001191036.2 NP_001177965.1 Accepted alive Link to Nucleotide Sequence:NM_001191036.2Link to Protein Sequence:NP_001177965.1Re-query CCDS DB by Nucleotide ID:NM_001191036Re-query CCDS DB by Protein ID:NP_001177965Link to BLAST:NP_001177965.1

RefSeq Length Related UniProtKB/SwissProt Length Identity Gaps Mismatches
NP_001165266.1 86 Q629K1 86 100% 0 0
NP_001165267.1 86 Q629K1 86 100% 0 0
NP_001165268.1 86 Q629K1 86 100% 0 0
NP_001165269.1 86 Q629K1 86 100% 0 0
NP_001165270.1 86 Q629K1 86 100% 0 0
NP_001177964.1 86 Q629K1 86 100% 0 0
NP_001177965.1 86 Q629K1 86 100% 0 0

Chromosomal Locations for CCDS 55261.1

Assembly GRCh38.p14 (GCF_000001405.40)

On '-' strand of Chromosome 8 (NC_000008.11)
Genome Browser links: Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 8Link to Ensembl Genome Browser on chromosome 8See the combined annotation on chromosome 8 in Sequence Viewer

Chromosome Start Stop Links
8 92886622 92886735 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 8Link to Ensembl Genome Browser on chromosome 8
8 92891989 92892074 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 8Link to Ensembl Genome Browser on chromosome 8
8 92916929 92916989 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 8Link to Ensembl Genome Browser on chromosome 8

CCDS Sequence Data
Blue highlighting indicates alternating exons.
Red highlighting indicates amino acids encoded across a splice junction.
 
Mouse over the nucleotide or protein sequence below and click on the highlighted codon or residue to select the pair.

Nucleotide Sequence (261 nt):
ATGGGTAGAAAAGATGCTGCTACTATAAAACTTCCTGTTGATCAGTACAGAAAACAAATTGGTAAACAGG
AT
TATAAAAAAACTAAACCTATTTTACGAGCAACCAAATTAAAAGCAGAAGCAAAGAAAACAGCAATAGG
C
ATAAAGGAAGTTGGCCTTGTACTTGCAGCTATATTGGCACTACTACTGGCTTTCTATGCTTTCTTTTAT
CTC
AGACTCACCACGGATGTTGACCCTGATCTGGACCAAGATGAAGATTAG


Translation (86 aa):
MGRKDAATIKLPVDQYRKQIGKQDYKKTKPILRATKLKAEAKKTAIGIKEVGLVLAAILALLLAFYAFFY
L
RLTTDVDPDLDQDED




Links Key
 Links to:   History report
  BLAST report
  Entrez Gene
  Nucleotide report
  Protein report
 Re-query CCDS DB by:   CCDS ID
  Gene ID
  Nucleotide ID
  Protein ID
 Genome Browser Links:   Ensembl Genome Browser
  NCBI Sequence Viewer
  UCSC Genome Browser
  VEGA Genome Browser