MIGS Eukaryotic sample from Oxyrrhis marina

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Identifiers: BioSample: SAMN02740391; Sample name: MMETSP0044; SRA: SRS621305

Organism: Oxyrrhis marina
cellular organisms; Eukaryota; Sar; Alveolata; Dinophyceae; Oxyrrhinales; Oxyrrhinaceae; Oxyrrhis

Attributes

estimated size	missing
strain	CCMP1788
ploidy	missing
latitude and longitude	missing
collection date	missing
local-scale environmental context	missing
project name	Marine microbial eukaryote transcriptome sequencing project
geographic location	missing
environmental medium	missing
reference for biomaterial	missing
number of replicons	missing
biomaterial provider	Claudio Slamovits
isolation and growth condition	missing
broad-scale environmental context	missing
propagation	missing
depth	missing
pi_first_name	Claudio
clonal	unknown
cDNA_adapter_5'	CTTAAGATGGAGTCTCCTCAGTATA
exp_modif_growth	added Valine, Cholesterol and Ubiquinone
exp_ammonium	100 umol/L
exp_urea
exp_total_fe
exp_date	1-Dec-2010
cDNA_adapter_3'	none
exp_silicate	0 umol/L
exp_light	286 (umol photons/m^2/s)
exp_salinity	18.5 psu
camera_sample_acc	CAM_SMPL_002371
exp_growth_medium	f/2 amended seawater
exp_phosphate	36 umol/L
exp_day_portion_of_day	16 hr
exp_night_portion_of_day	8 hr
exp_temperature	25 C
axenic	no
exp_trace_elements_total	276 nmol/L
exp_nitrate	880 umol/L
habitat_description	rocky shores, tide pools
pi_last_name	Slamovits
exp_ph	8

BioProjects: PRJEB37117
Retrieve all samples from this project

PRJNA248394 Marine Microbial Eukaryote Transcriptome Sequencing Project
Retrieve all samples from this project