NIH_MGC_135

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Organism: Mus musculus (house mouse)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus

Attributes

lab host	DH10B (phage-resistant)
vector	pCMVSport6.1
v_type	phagemid (ampicillin resistant)
re_1	EcoRV
re_2	NotI

Description: Normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 12.5, 13.5, 14.5, and 15.5 (size selected for the 0.5-1 kb fragments) Cloned directionally, priming method: Oligo-dT. cDNA enrichment: >1k bp, Average insert size 1.6k bp. Normalization (Cot value): 7.5 kb. Priming sequence: 5'GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)3' Tissue contributed by, David Rowe. Library constructed by ResGen, Invitrogen Corp.