Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 12.5, 13.5, 14.5, and 15.5 (size selected for the 0.5-1 kb fragments) Cloned directionally, priming method: Oligo-dT. cDNA enrichment: >1k bp, Average insert size 1.6k bp. Normalization (Cot value): 7.5 kb. Priming sequence: 5'GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)3' Tissue contributed by, David Rowe. Library constructed by ResGen, Invitrogen Corp.
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on