First strand cDNA was primed with an anchored XhoI-oligo(dT) primer [5'GGAGGACTCGAGCGGCCGCAGGAGGAG(T)VN 3'; V=A,C,G; N=A,C,G,T] and then dG tailed. Second strand was primed with a BamH1-dC primer [5'AGAGAGCTCGGATCCGCGGCCGCAATAATAATAAT(C) 3']. Double-stranded cDNA was then digested with BamH1 and XhoI and directionally cloned into the BamH1 and Sa1I sites of lambda pSB vector. Library went through one round of normalization. Library was constructed by Wei Yu at RIKEN of Japan (Carninci P, Westover A, Nishiyama Y, Ohsumi T, Itoh M, Nagaoka S, SasakiN, Okazaki Y, Muramatsu M, Schneider C, Hayashizaki Y, High efficiency selection of full-length cDNA by improved biotinylated cap trapper., DNA Res 4: 1, 61-6, Feb 28, 1997)