This sequence change creates a premature translational stop signal (p.Pro287Argfs*75) in the FOXL2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 90 amino acid(s) of the FOXL2 protein. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This premature translational stop signal has been observed in individual(s) with blepharophimosis-ptosis-epicanthus inversus syndrome (PMID: 12529855, 31048069). In at least one individual the variant was observed to be de novo. It has also been observed to segregate with disease in related individuals. This variant is also known as 1080-1096dup17. ClinVar contains an entry for this variant (Variation ID: 162045). For these reasons, this variant has been classified as Pathogenic.
ClinVar Genomic variation as it relates to human health
NM_023067.4(FOXL2):c.843_859dup (p.Pro287fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(17)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic/Likely pathogenic
17
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_023067.4(FOXL2):c.843_859dup (p.Pro287fs)
Variation ID: 162045 Accession: VCV000162045.42
- Type and length
-
Duplication, 17 bp
- Location
-
Cytogenetic: 3q22.3 3: 138945863-138945864 (GRCh38) [ NCBI UCSC ] 3: 138664705-138664706 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 20, 2014 Oct 20, 2024 Mar 26, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_023067.4:c.843_859dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_075555.1:p.Pro287fs frameshift NC_000003.12:g.138945865_138945881dup NC_000003.11:g.138664707_138664723dup NG_012454.1:g.6261_6277dup NG_029796.1:g.3632_3648dup LRG_1295:g.6261_6277dup LRG_1295t1:c.843_859dup LRG_1295p1:p.Pro287fs - Protein change
- P287fs
- Other names
- -
- Canonical SPDI
- NC_000003.12:138945863:GAGGCGGGGGTGCGGCCG:GAGGCGGGGGTGCGGCCGAGGCGGGGGTGCGGCCG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| FOXL2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
238 | 273 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (12) |
criteria provided, multiple submitters, no conflicts
|
Mar 26, 2024 | RCV000149462.26 | |
| Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Oct 24, 2023 | RCV001815208.26 | |
| Likely pathogenic (1) |
criteria provided, single submitter
|
Nov 13, 2023 | RCV003398794.1 | |
|
FOXL2-related disorder
|
Pathogenic (1) |
criteria provided, single submitter
|
Jul 17, 2023 | RCV003415986.5 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Nov 03, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia
Accession: SCV000484896.1
First in ClinVar: Oct 05, 2015 Last updated: Oct 05, 2015
Comment:
Clinical Testing
|
Number of individuals with the variant: 26
|
|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
de novo
|
Suma Genomics
Accession: SCV002097021.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
|
|
Likely pathogenic
(Nov 13, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Premature ovarian failure 3
Affected status: yes
Allele origin:
germline
|
Molecular Genetics and NGS Laboratory, Hospital Fundacion Valle Del Lili
Accession: SCV004121695.1
First in ClinVar: Nov 20, 2023 Last updated: Nov 20, 2023 |
Number of individuals with the variant: 1
Age: 30-39 years
Sex: female
Ethnicity/Population group: Latin
Geographic origin: Colombia
|
|
|
Pathogenic
(Sep 27, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Revvity Omics, Revvity
Accession: SCV003822114.2
First in ClinVar: Mar 04, 2023 Last updated: Feb 04, 2024 |
|
|
|
Pathogenic
(Oct 24, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV003525290.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 14, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Pro287Argfs*75) in the FOXL2 gene. While this is not anticipated to result in nonsense mediated decay, … (more)
This sequence change creates a premature translational stop signal (p.Pro287Argfs*75) in the FOXL2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 90 amino acid(s) of the FOXL2 protein. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This premature translational stop signal has been observed in individual(s) with blepharophimosis-ptosis-epicanthus inversus syndrome (PMID: 12529855, 31048069). In at least one individual the variant was observed to be de novo. It has also been observed to segregate with disease in related individuals. This variant is also known as 1080-1096dup17. ClinVar contains an entry for this variant (Variation ID: 162045). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Pathogenic
(Mar 26, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne
Accession: SCV005016502.1
First in ClinVar: May 01, 2024 Last updated: May 01, 2024 |
|
|
|
Pathogenic
(Jan 01, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
paternal,
unknown,
de novo
|
Wessex Regional Genetics Laboratory, Salisbury District Hospital
Accession: SCV000924440.1
First in ClinVar: Jun 23, 2019 Last updated: Jun 23, 2019 |
Observation 1:
Number of individuals with the variant: 1
Observation 2:
Number of individuals with the variant: 1
Observation 3:
Number of individuals with the variant: 1
Observation 4:
Number of individuals with the variant: 1
Observation 5:
Number of individuals with the variant: 1
Observation 6:
Number of individuals with the variant: 1
Observation 7:
Number of individuals with the variant: 1
Observation 8:
Number of individuals with the variant: 1
Observation 9:
Number of individuals with the variant: 1
Observation 10:
Number of individuals with the variant: 1
Observation 11:
Number of individuals with the variant: 1
Observation 12:
Number of individuals with the variant: 1
Observation 13:
Number of individuals with the variant: 1
Observation 14:
Number of individuals with the variant: 1
Observation 15:
Number of individuals with the variant: 1
Observation 16:
Number of individuals with the variant: 1
Observation 17:
Number of individuals with the variant: 1
Observation 18:
Number of individuals with the variant: 1
Observation 19:
Number of individuals with the variant: 1
|
|
|
Pathogenic
(Jul 02, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline,
paternal
|
Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München
Accession: SCV001150108.1
First in ClinVar: Feb 03, 2020 Last updated: Feb 03, 2020 |
Observation 1:
Sex: male
Tissue: blood
Observation 2:
Sex: female
Tissue: blood
|
|
|
Pathogenic
(May 03, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
unknown
|
Genomic Research Center, Shahid Beheshti University of Medical Sciences
Accession: SCV001251725.1
First in ClinVar: May 31, 2020 Last updated: May 31, 2020 |
|
|
|
Pathogenic
(Mar 10, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
MGZ Medical Genetics Center
Accession: SCV002581478.1
First in ClinVar: Oct 15, 2022 Last updated: Oct 15, 2022
Comment:
ACMG criteria applied: PVS1, PS4, PM1, PP1_MOD, PM2_SUP
|
Number of individuals with the variant: 1
Sex: female
|
|
|
Pathogenic
(Oct 15, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
(Autosomal dominant inheritance)
Affected status: unknown
Allele origin:
germline
|
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute
Additional submitter:
Shariant Australia, Australian Genomics
Accession: SCV002768590.1
First in ClinVar: Dec 24, 2022 Last updated: Dec 24, 2022 |
Comment:
Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0103 - Dominant negative and loss of function are … (more)
Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0103 - Dominant negative and loss of function are suggested mechanisms of disease in this gene and are associated with both Type I and II BPES (MIM# 110100). Depending on the assay, both mechanisms have been demonstrated for a given variant (PMID: 18635577, 19515849). (I) 0107 - This gene is associated with autosomal dominant disease with a single family reported for autosomal inheritance (OMIM). (I) 0115 - Variants in this gene are known to have variable expressivity (PMID: 12529855). (I) 0205 - Variant is predicted to result in a truncated protein. The premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction with less than 1/3 of the protein sequence affected. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0604 - Variant is not affecting an established domain, motif, hotspot or informative constraint region. (I) 0701 - Other downstream truncating variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (ClinVar). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals with both Type I and Type II blepharophimosis, epicanthus inversus, and ptosis (BPES) with or without premature ovarian insufficiency, respectively (MIM# 110100) and is considered as a recurrent variant (ClinVar; PMID: 31077882). (SP) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign (less)
|
|
|
Pathogenic
(Nov 29, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center
Accession: SCV003799003.2
First in ClinVar: Feb 13, 2023 Last updated: Mar 04, 2023 |
Comment:
PVS1, PS4, PM2, PM6
|
|
|
Pathogenic
(Jul 17, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
FOXL2-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004116592.1
First in ClinVar: Nov 20, 2023 Last updated: Nov 20, 2023 |
Comment:
The FOXL2 c.843_859dup17 variant is predicted to result in a frameshift and premature protein termination (p.Pro287Argfs*75). This variant has been reported as a mutational hotspot … (more)
The FOXL2 c.843_859dup17 variant is predicted to result in a frameshift and premature protein termination (p.Pro287Argfs*75). This variant has been reported as a mutational hotspot in the FOXL2 gene and causative for autosomal dominant blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) type I and II (reported as 1080-1096dup17 in De Baere et al. 2003. PubMed ID: 12529855; Beysen et al. 2008. PubMed ID: 18642388; Chacón-Camacho et al. 2019. PubMed ID: 31048069). In many of the individuals in these reports, the variant was found to have arisen de novo. This variant is classified as pathogenic by multiple independent submitters to the ClinVar database (https://www.ncbi.nlm.nih.gov/clinvar/variation/162045/). Given the evidence, we interpret FOXL2 c.843_859dup (p.Pro287Argfs*75) as pathogenic. (less)
|
|
|
Pathogenic
(Sep 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV002062507.20
First in ClinVar: Jan 29, 2022 Last updated: Oct 20, 2024 |
Comment:
FOXL2: PVS1, PM2, PS4:Supporting
Number of individuals with the variant: 3
|
|
|
Pathogenic
(Feb 12, 2010)
|
no assertion criteria provided
Method: clinical testing
|
BPES
Affected status: yes
Allele origin:
germline
|
Center for Medical Genetics Ghent, University of Ghent
Accession: SCV000196106.1
First in ClinVar: Dec 20, 2014 Last updated: Dec 20, 2014 |
|
|
|
Pathogenic
(Oct 09, 2023)
|
no assertion criteria provided
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
Zotz-Klimas Genetics Lab, MVZ Zotz Klimas
Accession: SCV004041674.1
First in ClinVar: Oct 14, 2023 Last updated: Oct 14, 2023 |
|
|
|
not provided
(-)
|
no classification provided
Method: literature only
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
GeneReviews
Accession: SCV000207364.2
First in ClinVar: Oct 05, 2015 Last updated: Oct 01, 2022 |
|
|
| click to load more click to collapse | |||||
Comment:
Comment:
Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0103 - Dominant negative and loss of function are suggested mechanisms of disease in this gene and are associated with both Type I and II BPES (MIM# 110100). Depending on the assay, both mechanisms have been demonstrated for a given variant (PMID: 18635577, 19515849). (I) 0107 - This gene is associated with autosomal dominant disease with a single family reported for autosomal inheritance (OMIM). (I) 0115 - Variants in this gene are known to have variable expressivity (PMID: 12529855). (I) 0205 - Variant is predicted to result in a truncated protein. The premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction with less than 1/3 of the protein sequence affected. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0604 - Variant is not affecting an established domain, motif, hotspot or informative constraint region. (I) 0701 - Other downstream truncating variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (ClinVar). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals with both Type I and Type II blepharophimosis, epicanthus inversus, and ptosis (BPES) with or without premature ovarian insufficiency, respectively (MIM# 110100) and is considered as a recurrent variant (ClinVar; PMID: 31077882). (SP) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign
Comment:
PVS1, PS4, PM2, PM6
Comment:
The FOXL2 c.843_859dup17 variant is predicted to result in a frameshift and premature protein termination (p.Pro287Argfs*75). This variant has been reported as a mutational hotspot in the FOXL2 gene and causative for autosomal dominant blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) type I and II (reported as 1080-1096dup17 in De Baere et al. 2003. PubMed ID: 12529855; Beysen et al. 2008. PubMed ID: 18642388; Chacón-Camacho et al. 2019. PubMed ID: 31048069). In many of the individuals in these reports, the variant was found to have arisen de novo. This variant is classified as pathogenic by multiple independent submitters to the ClinVar database (https://www.ncbi.nlm.nih.gov/clinvar/variation/162045/). Given the evidence, we interpret FOXL2 c.843_859dup (p.Pro287Argfs*75) as pathogenic.
Comment:
FOXL2: PVS1, PM2, PS4:Supporting
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
This sequence change creates a premature translational stop signal (p.Pro287Argfs*75) in the FOXL2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 90 amino acid(s) of the FOXL2 protein. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This premature translational stop signal has been observed in individual(s) with blepharophimosis-ptosis-epicanthus inversus syndrome (PMID: 12529855, 31048069). In at least one individual the variant was observed to be de novo. It has also been observed to segregate with disease in related individuals. This variant is also known as 1080-1096dup17. ClinVar contains an entry for this variant (Variation ID: 162045). For these reasons, this variant has been classified as Pathogenic.
Comment:
Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0103 - Dominant negative and loss of function are suggested mechanisms of disease in this gene and are associated with both Type I and II BPES (MIM# 110100). Depending on the assay, both mechanisms have been demonstrated for a given variant (PMID: 18635577, 19515849). (I) 0107 - This gene is associated with autosomal dominant disease with a single family reported for autosomal inheritance (OMIM). (I) 0115 - Variants in this gene are known to have variable expressivity (PMID: 12529855). (I) 0205 - Variant is predicted to result in a truncated protein. The premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction with less than 1/3 of the protein sequence affected. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0604 - Variant is not affecting an established domain, motif, hotspot or informative constraint region. (I) 0701 - Other downstream truncating variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (ClinVar). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals with both Type I and Type II blepharophimosis, epicanthus inversus, and ptosis (BPES) with or without premature ovarian insufficiency, respectively (MIM# 110100) and is considered as a recurrent variant (ClinVar; PMID: 31077882). (SP) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign
Comment:
PVS1, PS4, PM2, PM6
Comment:
The FOXL2 c.843_859dup17 variant is predicted to result in a frameshift and premature protein termination (p.Pro287Argfs*75). This variant has been reported as a mutational hotspot in the FOXL2 gene and causative for autosomal dominant blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) type I and II (reported as 1080-1096dup17 in De Baere et al. 2003. PubMed ID: 12529855; Beysen et al. 2008. PubMed ID: 18642388; Chacón-Camacho et al. 2019. PubMed ID: 31048069). In many of the individuals in these reports, the variant was found to have arisen de novo. This variant is classified as pathogenic by multiple independent submitters to the ClinVar database (https://www.ncbi.nlm.nih.gov/clinvar/variation/162045/). Given the evidence, we interpret FOXL2 c.843_859dup (p.Pro287Argfs*75) as pathogenic.
Comment:
FOXL2: PVS1, PM2, PS4:Supporting
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Blepharophimosis, Ptosis, and Epicanthus Inversus Syndrome. | Adam MP | - | 2022 | PMID: 20301614 |
| Screening of a large cohort of blepharophimosis, ptosis, and epicanthus inversus syndrome patients reveals a very strong paternal inheritance bias and a wide spectrum of novel FOXL2 mutations. | Bunyan DJ | European journal of medical genetics | 2019 | PMID: 31077882 |
| Clinical characterization and identification of five novel FOXL2 pathogenic variants in a cohort of 12 Mexican subjects with the syndrome of blepharophimosis-ptosis-epicanthus inversus. | Chacón-Camacho OF | Gene | 2019 | PMID: 31048069 |
| Towards a functional classification of pathogenic FOXL2 mutations using transactivation reporter systems. | Dipietromaria A | Human molecular genetics | 2009 | PMID: 19515849 |
| The identification and characterization of a FOXL2 response element provides insights into the pathogenesis of mutant alleles. | Benayoun BA | Human molecular genetics | 2008 | PMID: 18635577 |
| FOXL2 and BPES: mutational hotspots, phenotypic variability, and revision of the genotype-phenotype correlation. | De Baere E | American journal of human genetics | 2003 | PMID: 12529855 |
Text-mined citations for rs672601359 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Nov 10, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.