PRNP[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 207

<< First< Prev

Page of 3

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 150785	GRCh38/hg38 20p13-12.3(chr20:80093-6386012)x3	LOC130065401, LOC130065402 +348 more	Copy number gain	See cases	GPathogenic
Select item 149704	GRCh38/hg38 20p13-12.1(chr20:80106-13029401)x3	LOC130065344, LOC130065345 +455 more	Copy number gain	See cases	GPathogenic
Select item 144514	GRCh38/hg38 20p13-q11.1(chr20:80106-30227427)x3	LOC129456123, LOC130065248 +833 more	Copy number gain	See cases	GPathogenic
Select item 154176	GRCh38/hg38 20p13-12.3(chr20:80927-5447679)x3	LOC112694699, LOC112694712 +306 more	Copy number gain	See cases	GUncertain significance
Select item 153731	GRCh38/hg38 20p13-11.1(chr20:80927-26324843)x3	ABHD12, ACSS1 +828 more	Copy number gain	See cases	GPathogenic
Select item 155359	GRCh38/hg38 20p13-11.23(chr20:80928-18688031)x3	ADAM33, ADISSP +571 more	Copy number gain	See cases	GPathogenic
Select item 152841	GRCh38/hg38 20p13-12.3(chr20:84402-6159078)x3	LOC114004355, LOC116286198 +347 more	Copy number gain	See cases	GPathogenic
Select item 2579201	GRCh38/hg38 20p13-11.21(chr20:87153-23635465)x3	ADAM33, ADISSP +731 more	Copy number gain	Renal agenesis	GPathogenic
Select item 59191	GRCh38/hg38 20p13-11.23(chr20:89939-19071495)x3	ADAM33, ADISSP +579 more	Copy number gain	See cases	GPathogenic
Select item 57514	GRCh38/hg38 20p13-11.21(chr20:89939-25697564)x3	FASTKD5, FERMT1 +814 more	Copy number gain	See cases	GPathogenic
Select item 57354	GRCh38/hg38 20p13-11.23(chr20:89939-19146279)x3	LOC130065324, LOC130065325 +581 more	Copy number gain	See cases	GPathogenic
Select item 146596	GRCh38/hg38 20p13-q13.33(chr20:99557-64277321)x3	JPH2, KAT14 +2522 more	Copy number gain	See cases	GPathogenic
Select item 154850	GRCh38/hg38 20p13-12.3(chr20:1269303-8626911)x3	LOC130065322, LOC130065323 +300 more	Copy number gain	See cases	GPathogenic
Select item 148627	GRCh38/hg38 20p13-12.3(chr20:4343033-6911730)x1	BMP2, CASC20 +101 more	Copy number loss	See cases	GPathogenic
Select item 146302	GRCh38/hg38 20p13(chr20:4594991-5050271)x3	LOC111240478, LOC111240479 +25 more	Copy number gain	See cases	GUncertain significance
Select item 338638	NM_000311.4(PRNP):c.-310T>A	PRNP	Single nucleotide variant	Inherited prion disease	GUncertain significance
Select item 338639	NM_000311.4(PRNP):c.-245C>G	PRNP	Single nucleotide variant	not provided +1 more	GBenign
Select item 338640	NM_000311.4(PRNP):c.-211G>A	PRNP	Single nucleotide variant	Inherited prion disease	GUncertain significance
Select item 338641	NM_000311.4(PRNP):c.-206C>G	PRNP	Single nucleotide variant	Inherited prion disease	GUncertain significance
Select item 338642	NM_000311.5(PRNP):c.-22C>G	PRNP	Single nucleotide variant (5 prime UTR variant)	Inherited prion disease	GUncertain significance
Select item 338643	NM_000311.5(PRNP):c.-21G>T	PRNP	Single nucleotide variant (5 prime UTR variant)	Inherited prion disease	GUncertain significance
Select item 338644	NM_000311.5(PRNP):c.-18C>T	PRNP	Single nucleotide variant (5 prime UTR variant)	Inherited prion disease	GBenign
Select item 1236587	NM_000311.5(PRNP):c.-10-21G>A	PRNP	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 899176	NM_000311.5(PRNP):c.5C>T (p.Ala2Val)	PRNP (A2V)	Single nucleotide variant (missense variant +1 more)	Inherited prion disease +1 more	GConflicting classifications of pathogenicity
Select item 2004547	NM_000311.5(PRNP):c.6G>A (p.Ala2=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 3310263	NM_000311.5(PRNP):c.40G>T (p.Ala14Ser)	PRNP (A14S)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 871372	NM_000311.5(PRNP):c.50G>C (p.Ser17Thr)	PRNP (S17T)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1 +1 more	GUncertain significance
Select item 2727133	NM_000311.5(PRNP):c.54C>T (p.Asp18=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 1606105	NM_000311.5(PRNP):c.57G>A (p.Leu19=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 2053967	NM_000311.5(PRNP):c.74G>A (p.Arg25His)	PRNP (R25H)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 899177	NM_000311.5(PRNP):c.76C>G (p.Pro26Ala)	PRNP (P26A)	Single nucleotide variant (missense variant +1 more)	Inherited prion disease	GUncertain significance
Select item 2571133	NM_000311.5(PRNP):c.78G>A (p.Pro26=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1495663	NM_000311.5(PRNP):c.86G>A (p.Gly29Glu)	PRNP (G29E)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 3253499	NM_000311.5(PRNP):c.88G>A (p.Gly30Arg)	PRNP (G30R)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2207104	NM_000311.5(PRNP):c.110G>A (p.Arg37Gln)	PRNP (R37Q)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 899178	NM_000311.5(PRNP):c.116C>T (p.Pro39Leu)	PRNP (P39L)	Single nucleotide variant (missense variant +1 more)	Inherited prion disease +1 more	GConflicting classifications of pathogenicity
Select item 1556415	NM_000311.5(PRNP):c.117G>A (p.Pro39=)	PRNP (G10R)	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 1980378	NM_000311.5(PRNP):c.120G>A (p.Gly40=)	PRNP (A11T)	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GBenign
Select item 2167988	NM_000311.5(PRNP):c.138C>T (p.Gly46=)	PRNP (Q17*)	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 895060	NM_000311.5(PRNP):c.143G>A (p.Arg48His)	PRNP (R48H)	Single nucleotide variant (missense variant +1 more)	not provided +1 more	GUncertain significance
Select item 2683528	NM_000311.5(PRNP):c.180TCATGGTGGTGGCTGGGGGCAGCC[3] (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGln)	PRNP	Microsatellite (inframe insertion)	not provided	GUncertain significance
Select item 2021683	NM_000311.5(PRNP):c.227_228insTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln)	PRNP	Microsatellite (inframe_insertion)	Huntington disease-like 1	GUncertain significance
Select item 689659	NM_000311.5(PRNP):c.227_228insTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln)	PRNP	Microsatellite (inframe_insertion)	PRNP-associated condition	GPathogenic
Select item 338645	NM_000311.5(PRNP):c.159C>T (p.Gly53=)	PRNP (R24W)	Single nucleotide variant (synonymous variant +1 more)	not provided +7 more	GBenign/Likely benign
Select item 13394	NM_000311.5(PRNP):c.154_177[6_13]	PRNP	Microsatellite	Inherited prion disease +3 more	GPathogenic
Select item 858815	NM_000311.5(PRNP):c.180_227del (p.60_67PHGGGWGQ[2])	PRNP	Deletion (inframe_deletion)	Huntington disease-like 1	GUncertain significance
Select item 338646	NM_000311.5(PRNP):c.160G>A (p.Gly54Ser)	PRNP (G54S +1 more)	Single nucleotide variant (missense variant)	Huntington disease-like 1 +2 more	GBenign/Likely benign
Select item 65494	NM_000311.3(PRNP):c.204_227del24 (p.Pro84_Gln91del)	PRNP	Microsatellite (inframe_deletion)	Huntington disease-like 1 +6 more	GLikely benign
Select item 453305	NM_000311.5(PRNP):c.180T>C (p.Pro60=)	PRNP (S31P)	Single nucleotide variant (synonymous variant +1 more)	Spongiform encephalopathy with neuropsychiatric features	GUncertain significance
Select item 453304	NM_000311.5(PRNP):c.198G>A (p.Gly66=)	PRNP (A37T)	Single nucleotide variant (synonymous variant +1 more)	Spongiform encephalopathy with neuropsychiatric features	GUncertain significance
Select item 338647	NM_000311.5(PRNP):c.204T>C (p.Pro68=)	PRNP (S39P)	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1 +2 more	GBenign
Select item 1496345	NM_000311.5(PRNP):c.222_245del (p.60PHGGGWGQ[3])	PRNP	Deletion (inframe_deletion)	not specified +1 more	GUncertain significance
Select item 1705547	NM_000311.5(PRNP):c.206A>T (p.His69Leu)	PRNP (H69L)	Single nucleotide variant (missense variant +1 more)	Gerstmann-Straussler-Scheinker syndrome	GUncertain significance
Select item 2318704	NM_000311.5(PRNP):c.214G>C (p.Gly72Arg)	PRNP (G72R +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 3336934	NM_000311.5(PRNP):c.218G>C (p.Trp73Ser)	PRNP (W73S)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1617003	NM_000311.5(PRNP):c.228_251del (p.60PHGGGWGQ[3])	PRNP	Deletion (inframe_deletion)	not provided +1 more	GLikely benign
Select item 1607151	NM_000311.5(PRNP):c.225G>A (p.Gln75=)	PRNP (A46T)	Single nucleotide variant (synonymous variant +1 more)	not provided +1 more	GLikely benign
Select item 218578	NM_000311.5(PRNP):c.228C>T (p.Pro76=)	PRNP (P47S)	Single nucleotide variant (synonymous variant +1 more)	not specified +3 more	GBenign/Likely benign
Select item 536237	NM_000311.5(PRNP):c.246_269del (p.60_67PHGGGWGQ[3])	PRNP	Deletion (inframe_deletion)	Huntington disease-like 1 +1 more	GBenign/Likely benign
Select item 338648	NM_000311.5(PRNP):c.246A>G (p.Gly82=)	PRNP (T53A)	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1 +2 more	GBenign
Select item 338649	NM_000311.5(PRNP):c.252T>C (p.Pro84=)	PRNP (S55P)	Single nucleotide variant (synonymous variant +1 more)	not provided +1 more	GBenign
Select item 1722211	NM_000311.5(PRNP):c.278G>A (p.Gly93Asp)	PRNP (G93D)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 3371022	NM_000311.5(PRNP):c.284C>A (p.Thr95Asn)	PRNP (H65Q +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2338908	NM_000311.5(PRNP):c.286C>G (p.His96Asp)	PRNP (H96D +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 1005336	NM_000311.5(PRNP):c.290G>A (p.Ser97Asn)	PRNP (S97N)	Single nucleotide variant (missense variant +1 more)	not specified +1 more	GUncertain significance
Select item 13395	NM_000311.5(PRNP):c.305C>T (p.Pro102Leu)	PRNP (P102L)	Single nucleotide variant (missense variant +1 more)	Inherited Creutzfeldt-Jakob disease +3 more	GPathogenic
Select item 766882	NM_000311.5(PRNP):c.306G>A (p.Pro102=)	PRNP (E73K)	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1 +6 more	GBenign/Likely benign
Select item 13415	NM_000311.5(PRNP):c.313C>T (p.Pro105Ser)	PRNP (P105S)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 13413	NM_000311.5(PRNP):c.313C>A (p.Pro105Thr)	PRNP (P105T)	Single nucleotide variant (missense variant +1 more)	Spongiform encephalopathy with neuropsychiatric features	GPathogenic
Select item 13404	NM_000311.5(PRNP):c.314C>T (p.Pro105Leu)	PRNP (P105L)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GPathogenic
Select item 1539263	NM_000311.5(PRNP):c.333C>T (p.His111=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 2815837	NM_000311.5(PRNP):c.350_351inv (p.Ala117Val)	PRNP (A117V)	Inversion (missense variant +1 more)	Huntington disease-like 1	GPathogenic
Select item 13396	NM_000311.5(PRNP):c.350C>T (p.Ala117Val)	PRNP (A117V)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GPathogenic
Select item 338650	NM_000311.5(PRNP):c.351A>G (p.Ala117=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Inherited prion disease +2 more	GBenign
Select item 753337	NM_000311.5(PRNP):c.366G>T (p.Val122=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 338651	NM_000311.5(PRNP):c.372C>G (p.Gly124=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Inherited prion disease +2 more	GBenign/Likely benign
Select item 13416	NM_000311.5(PRNP):c.380G>T (p.Gly127Val)	PRNP (G127V)	Single nucleotide variant (missense variant +1 more)	Kuru, protection against	Gprotective
Select item 1562637	NM_000311.5(PRNP):c.384_385inv (p.Met129Val)	PRNP (M129V)	Inversion (missense variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 13399	NM_000311.3(PRNP):c.[385A>G;532G>A]	PRNP (M129V +1 more)	Single nucleotide variant (missense variant +1 more)	Inherited Creutzfeldt-Jakob disease +1 more	GPathogenic
Select item 13397	NM_000311.5(PRNP):c.385A>G (p.Met129Val)	PRNP (M129V)	Single nucleotide variant (missense variant +1 more)	Fatal familial insomnia +7 more	GBenign/Likely benign
Select item 1334094	NM_000311.5(PRNP):c.392G>A (p.Gly131Glu)	PRNP (G131E)	Single nucleotide variant (missense variant +1 more)	Gerstmann-Straussler-Scheinker syndrome	GLikely pathogenic
Select item 13410	NM_000311.5(PRNP):c.392G>T (p.Gly131Val)	PRNP (G131V)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1 +1 more	GPathogenic/Likely pathogenic
Select item 2193800	NM_000311.5(PRNP):c.393A>G (p.Gly131=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 13414	NM_000311.5(PRNP):c.398C>T (p.Ala133Val)	PRNP (A133V)	Single nucleotide variant (missense variant +1 more)	Gerstmann-Straussler-Scheinker syndrome	GPathogenic
Select item 2185939	NM_000311.5(PRNP):c.402G>C (p.Met134Ile)	PRNP (M134I)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 1510828	NM_000311.5(PRNP):c.407G>C (p.Arg136Thr)	PRNP (R136T)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 1596929	NM_000311.5(PRNP):c.408G>A (p.Arg136=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 1503725	NM_000311.5(PRNP):c.408G>T (p.Arg136Ser)	PRNP (R136S)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 1685039	NM_000311.5(PRNP):c.414C>G (p.Ile138Met)	PRNP (I138M)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 450790	NM_000311.5(PRNP):c.415A>G (p.Ile139Val)	PRNP (I139V)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2887039	NM_000311.5(PRNP):c.423C>T (p.Phe141=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 338652	NM_000311.5(PRNP):c.424G>A (p.Gly142Ser)	PRNP (G142S)	Single nucleotide variant (missense variant +1 more)	not provided +2 more	GBenign/Likely benign
Select item 2578908	NM_000311.5(PRNP):c.432C>G (p.Asp144Glu)	PRNP (D144E)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 21147	NM_000311.5(PRNP):c.435T>G (p.Tyr145Ter)	PRNP (Y145*)	Single nucleotide variant (nonsense +1 more)	CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED	GPathogenic
Select item 1906531	NM_000311.5(PRNP):c.441C>T (p.Asp147=)	PRNP	Single nucleotide variant (synonymous variant +1 more)	Huntington disease-like 1	GLikely benign
Select item 1507942	NM_000311.5(PRNP):c.443G>A (p.Arg148His)	PRNP (R148H)	Single nucleotide variant (missense variant +1 more)	Inherited Creutzfeldt-Jakob disease +1 more	GLikely pathogenic
Select item 2042593	NM_000311.5(PRNP):c.446dup (p.Tyr149Ter)	PRNP (Y149*)	Duplication (nonsense +1 more)	Huntington disease-like 1	GUncertain significance
Select item 2153666	NM_000311.5(PRNP):c.451C>T (p.Arg151Cys)	PRNP (R151C)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 2081760	NM_000311.5(PRNP):c.452G>A (p.Arg151His)	PRNP (R151H)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1	GUncertain significance
Select item 1398824	NM_000311.5(PRNP):c.452G>T (p.Arg151Leu)	PRNP (R151L)	Single nucleotide variant (missense variant +1 more)	Huntington disease-like 1 +1 more	GUncertain significance

<< First< Prev

Page of 3