VCV000125993.7 - ClinVar

NM_000059.4(BRCA2):c.71_96del (p.Asp23_Leu24insTer)

Germline

Top reviewed classifications are shown here.

Submission summary:

4 submissions

4 submitters

2 conditions

Reviewed by expert panel

Pathogenic

Sep 2016 by Evidence-based…

for Breast-ovarian cancer, familial, susceptibility to, 2

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000059.4(BRCA2):c.71_96del (p.Asp23_Leu24insTer)

Variation ID: 125993 Accession: VCV000125993.7

Type and length

Deletion, 26 bp

Location

Cytogenetic: 13q13.1 13: 32319078-32319103 (GRCh38) [ NCBI UCSC ] 13: 32893215-32893240 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 4, 2014	May 1, 2024	Sep 8, 2016

HGVS

Nucleotide	Protein	Molecular consequence
NM_000059.4:c.71_96del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_000050.3:p.Asp23_Leu24insTer	nonsense
NM_000059.3:c.71_96delTAGGACCAATAAGTCTTAATTGGTTT
NC_000013.11:g.32319080_32319105del
NC_000013.10:g.32893217_32893242del
NG_012772.3:g.8601_8626del
NG_017006.2:g.1261_1286del
LRG_293:g.8601_8626del
LRG_293t1:c.71_96del26
U43746.1:n.299_324del26

... more HGVS ... less HGVS

Protein change

Other names

299del26

Canonical SPDI

NC_000013.11:32319077:TTTAGGACCAATAAGTCTTAATTGGTTT:TT

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

Breast Cancer Information Core (BIC) (BRCA2): 299&base_change=del 26 ClinGen: CA024953 dbSNP: rs80359637 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
BRCA2		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	18972	19131

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Breast-ovarian cancer, familial, susceptibility to, 2	Pathogenic (3)	reviewed by expert panel	Sep 8, 2016	RCV000113090.6
Hereditary cancer-predisposing syndrome	Pathogenic (1)	criteria provided, single submitter	Jul 9, 2016	RCV000509918.3

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Sep 08, 2016)	reviewed by expert panel (ENIGMA BRCA1/2 Classification Criteria (2015)) Method: curation	Breast-ovarian cancer, familial, susceptibility to, 2 Affected status: unknown Allele origin: germline	Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) Accession: SCV000300293.2 First in ClinVar: Sep 24, 2016 Last updated: Sep 24, 2016	Comment: Variant allele predicted to encode a truncated non-functional protein.
Likely pathogenic (Nov 26, 2014)	criteria provided, single submitter (Counsyl Autosomal Dominant Disease Classification criteria (2015)) Method: literature only	Breast-ovarian cancer, familial 2 (Autosomal dominant inheritance) Affected status: unknown Allele origin: unknown	Counsyl Accession: SCV000220915.2 First in ClinVar: Mar 29, 2015 Last updated: Dec 24, 2022	Publications: PubMed (2) PubMed: 21939546‚ 9150172
Pathogenic (Jul 09, 2016)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Hereditary cancer-predisposing syndrome Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV000608182.5 First in ClinVar: Oct 23, 2017 Last updated: May 01, 2024	Comment: The c.71_96del26 pathogenic mutation, located in coding exon 2 of the BRCA2 gene, results from a deletion of 26 nucleotides at nucleotide positions 71 to … (more) The c.71_96del26 pathogenic mutation, located in coding exon 2 of the BRCA2 gene, results from a deletion of 26 nucleotides at nucleotide positions 71 to 96, causing a translational frameshift with a predicted alternate stop codon (p.L24*). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
Pathogenic (Dec 30, 1999)	no assertion criteria provided Method: clinical testing	Breast-ovarian cancer, familial 2 Affected status: yes Allele origin: germline	Breast Cancer Information Core (BIC) (BRCA2) Accession: SCV000146106.1 First in ClinVar: Apr 04, 2014 Last updated: Apr 04, 2014	Number of individuals with the variant: 1 Ethnicity/Population group: Russian, Austrian

Comment:

The c.71_96del26 pathogenic mutation, located in coding exon 2 of the BRCA2 gene, results from a deletion of 26 nucleotides at nucleotide positions 71 to 96, causing a translational frameshift with a predicted alternate stop codon (p.L24*). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
An entire exon 3 germ-line rearrangement in the BRCA2 gene: pathogenic relevance of exon 3 deletion in breast cancer predisposition.	Muller D	BMC medical genetics	2011	PMID: 21939546
BRCA2 mutations in hereditary breast and ovarian cancer in France.	Serova-Sinilnikova OM	American journal of human genetics	1997	PMID: 9150172

Text-mined citations for rs80359637 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 01, 2024

ClinVar Genomic variation as it relates to human health

NM_000059.4(BRCA2):c.71_96del (p.Asp23_Leu24insTer)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs80359637 ...