VCV001727008.1 - ClinVar

NM_000342.4(SLC4A1):c.2687_2699dup (p.Gly900_Arg901insTer)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(0)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

no classification for the single variant

Somatic

Clinical impact

The aggregate somatic clinical impact for this variant for one or more tumor types, using the AMP/ASCO/CAP terminology. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(0)

Stars represent the aggregate review status, or the level of review supporting the aggregate somatic clinical impact for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

no classification for the single variant

Somatic

Oncogenicity

The aggregate oncogenicity classification for this variant for one or more tumor types, using the ClinGen/CGC/VICC terminology. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(0)

Stars represent the aggregate review status, or the level of review supporting the aggregate oncogenicity classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

no classification for the single variant

Variant Details

This variant is part of a Haplotype

NM_000342.4(SLC4A1):c.[2687_2699dup;2710_2718del]

Identifiers

NM_000342.4(SLC4A1):c.2687_2699dup (p.Gly900_Arg901insTer)

Variation ID: 1727008 Accession: VCV001727008.1

Type and length

Duplication, 13 bp

Location

Cytogenetic: 17q21.31 17: 44250494-44250495 (GRCh38) [ NCBI UCSC ] 17: 42327862-42327863 (GRCh37) [ NCBI UCSC ]

HGVS

Nucleotide	Protein	Molecular consequence
NM_000342.4:c.2687_2699dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_000333.1:p.Gly900_Arg901insTer	nonsense inframe insertion
NC_000017.11:g.44250496_44250508dup
NC_000017.10:g.42327864_42327876dup
NG_007498.1:g.22628_22640dup
LRG_803:g.22628_22640dup
LRG_803t1:c.2687_2699dup	LRG_803p1:p.Gly900_Arg901insTer

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000017.11:44250494:CCTTCCTCCTCATC:CCTTCCTCCTCATCCTTCCTCCTCATC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

OMIM: 109270.0025 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
SLC4A1		-	-	GRCh38 GRCh37	688	700

Conditions - Germline

There are no conditions for this variant because no interpretation for the single variant has been submitted to ClinVar yet.

Submissions - Germline

There are no Germline Classifications in ClinVar for this variation. If you know of any, please consider submitting that information to ClinVar.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Conditions - Somatic

There are no conditions for this variant because no interpretation for the single variant has been submitted to ClinVar yet.

Submissions - Somatic

There are no interpretations in ClinVar for this variation. If you know of any, please consider submitting that information to ClinVar.

Citations for somatic classification of this variant

There are no citations for somatic classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Mar 30, 2024

ClinVar Genomic variation as it relates to human health

NM_000342.4(SLC4A1):c.2687_2699dup (p.Gly900_Arg901insTer)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Conditions - Somatic

Submissions - Somatic

Citations for somatic classification of this variant

Text-mined citations for this variant ...