VCV001805114.1 - ClinVar

NM_001130004.2(ACTN1):c.631_651del (p.Val211_Asp217del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Uncertain significance

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001130004.2(ACTN1):c.631_651del (p.Val211_Asp217del)

Variation ID: 1805114 Accession: VCV001805114.1

Type and length

Deletion, 21 bp

Location

Cytogenetic: 14q24.1 14: 68904680-68904700 (GRCh38) [ NCBI UCSC ] 14: 69371397-69371417 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 24, 2022	Dec 24, 2022	Mar 31, 2022

HGVS

Nucleotide	Protein	Molecular consequence
NM_001130004.2:c.631_651del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001123476.1:p.Val211_Asp217del	inframe deletion
NM_001102.4:c.631_651del	NP_001093.1:p.Val211_Asp217del	inframe deletion
NM_001130004.1:c.628_648del21	NP_001123476.1:p.Val211_Asp217del	inframe indel
NM_001130005.2:c.631_651del	NP_001123477.1:p.Val211_Asp217del	inframe deletion
NM_001411035.1:c.628_648del21	NP_001397964.1:p.Val211_Asp217del	inframe indel
NM_001411036.1:c.433_453del21	NP_001397965.1:p.Val146_Asp152del	inframe indel
NC_000014.9:g.68904683_68904703del
NC_000014.8:g.69371400_69371420del
NG_029480.1:g.79667_79687del
LRG_886:g.79667_79687del
LRG_886t1:c.631_651del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000014.9:68904679:GTCCAGGTACTTCTCTGCCACGTC:GTC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ACTN1		-	-	GRCh38 GRCh37	385	397

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Platelet-type bleeding disorder 15	Uncertain significance (1)	criteria provided, single submitter	Mar 31, 2022	RCV002471532.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Uncertain significance (Mar 31, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Platelet-type bleeding disorder 15 (Autosomal dominant inheritance) Affected status: unknown Allele origin: germline	Victorian Clinical Genetics Services, Murdoch Childrens Research Institute Additional submitter: Shariant Australia, Australian Genomics Accession: SCV002768280.1 First in ClinVar: Dec 24, 2022 Last updated: Dec 24, 2022	Publications: PubMed (5) PubMed: 23434115‚ 26879394‚ 30351444‚ 31365757‚ 32478077 Comment: Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as VUS-3B. Following criteria are met: 0103 - Loss of function (LoF) and gain of … (more) Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as VUS-3B. Following criteria are met: 0103 - Loss of function (LoF) and gain of function (GoF) are reported mechanisms of disease in this gene and are associated with congenital macrothrombocytopenia (MIM#615193). LoF and GoF have been reported for missense variants, while the mechanism of disease for null variants is unclear (PMIDs: 23434115, 30351444, 26879394, 31365757). (I) 0107 - This gene is associated with autosomal dominant disease. (I) 0213 - In-frame deletion in a non-repetitive region that has high conservation. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0601 - Variant is located in the well-established functional CH2 domain. The CH2 domain binds in tandem with CH1 to form the actin binding domain in ACTN1 and facilitates high affinity binding to F-actin (DECIPHER, PMID: 32478077). (SP) 0705 - No comparable in-frame deletion variants have previous evidence for pathogenicity. (I) 0807 - This variant has no previous evidence of pathogenicity. (I) 0905 - No published segregation evidence has been identified for this variant. (I) 1007 - No published functional evidence has been identified for this variant. (I) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign (less)

Comment:

Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as VUS-3B. Following criteria are met: 0103 - Loss of function (LoF) and gain of function (GoF) are reported mechanisms of disease in this gene and are associated with congenital macrothrombocytopenia (MIM#615193). LoF and GoF have been reported for missense variants, while the mechanism of disease for null variants is unclear (PMIDs: 23434115, 30351444, 26879394, 31365757). (I) 0107 - This gene is associated with autosomal dominant disease. (I) 0213 - In-frame deletion in a non-repetitive region that has high conservation. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0601 - Variant is located in the well-established functional CH2 domain. The CH2 domain binds in tandem with CH1 to form the actin binding domain in ACTN1 and facilitates high affinity binding to F-actin (DECIPHER, PMID: 32478077). (SP) 0705 - No comparable in-frame deletion variants have previous evidence for pathogenicity. (I) 0807 - This variant has no previous evidence of pathogenicity. (I) 0905 - No published segregation evidence has been identified for this variant. (I) 1007 - No published functional evidence has been identified for this variant. (I) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Structural Characteristics, Binding Partners and Related Diseases of the Calponin Homology (CH) Domain.	Yin LM	Frontiers in cell and developmental biology	2020	PMID: 32478077
Investigation of calmodulin-like and rod domain mutations suggests common molecular mechanism for α-actinin-1-linked congenital macrothrombocytopenia.	O'Sullivan LR	FEBS letters	2020	PMID: 31365757
ACTN1 mutations lead to a benign form of platelet macrocytosis not always associated with thrombocytopenia.	Faleschini M	British journal of haematology	2018	PMID: 30351444
Congenital macrothrombocytopenia-linked mutations in the actin-binding domain of α-actinin-1 enhance F-actin association.	Murphy AC	FEBS letters	2016	PMID: 26879394
ACTN1 mutations cause congenital macrothrombocytopenia.	Kunishima S	American journal of human genetics	2013	PMID: 23434115

Text-mined citations for this variant ...

Record last updated Dec 24, 2022

ClinVar Genomic variation as it relates to human health

NM_001130004.2(ACTN1):c.631_651del (p.Val211_Asp217del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...