ClinVar Genomic variation as it relates to human health
NM_000540.3(RYR1):c.957+5_957+29del
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000540.3(RYR1):c.957+5_957+29del
Variation ID: 193600 Accession: VCV000193600.18
- Type and length
-
Deletion, 25 bp
- Location
-
Cytogenetic: 19q13.2 19: 38448513-38448537 (GRCh38) [ NCBI UCSC ] 19: 38939156-38939180 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jun 29, 2015 Apr 15, 2024 Jul 7, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000540.3:c.957+5_957+29del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
splice donor NM_000540.2:c.957+5_957+29del25 NM_000540.2:c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCA splice donor NM_001042723.2:c.957+5_957+29del splice donor NC_000019.10:g.38448516_38448540del NC_000019.9:g.38939156_38939180del NG_008866.1:g.19817_19841del LRG_766:g.19817_19841del - Protein change
- Other names
- -
- Canonical SPDI
- NC_000019.10:38448512:TCAGTGGGGTTTGTGGCGCCCTCCCTCA:TCA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
RYR1 | No evidence available | No evidence available |
GRCh38 GRCh37 |
8875 | 9189 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Uncertain significance (1) |
criteria provided, single submitter
|
Mar 28, 2016 | RCV000173706.5 | |
Uncertain significance (1) |
criteria provided, single submitter
|
Oct 19, 2022 | RCV000655587.6 | |
Uncertain significance (4) |
criteria provided, multiple submitters, no conflicts
|
May 24, 2023 | RCV000721748.14 | |
Uncertain significance (1) |
criteria provided, single submitter
|
Mar 27, 2022 | RCV002281998.1 | |
Uncertain significance (1) |
criteria provided, single submitter
|
Jul 7, 2023 | RCV003993854.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(Dec 08, 2014)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000224851.5
First in ClinVar: Jun 29, 2015 Last updated: Dec 15, 2018 |
Number of individuals with the variant: 1
Sex: mixed
|
|
Uncertain significance
(Sep 15, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV001764682.1
First in ClinVar: Aug 07, 2021 Last updated: Aug 07, 2021 |
Comment:
Has not been previously published as pathogenic or benign to our knowledge; In silico analysis, which includes splice predictors and evolutionary conservation, supports a deleterious … (more)
Has not been previously published as pathogenic or benign to our knowledge; In silico analysis, which includes splice predictors and evolutionary conservation, supports a deleterious effect (less)
|
|
Uncertain significance
(Mar 28, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV000540242.1
First in ClinVar: Jun 29, 2015 Last updated: Jun 29, 2015 |
Comment:
Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or … (more)
Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or databases. Disclaimer: This variant has not undergone full assessment. The following are preliminary notes: Intronic deletion, possible weak splice impact; ExAC: 0.1% (12/11570) Latino chromosomes (does not pass quality filter) (less)
Method: Genome/Exome Filtration
|
|
Uncertain significance
(Feb 03, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV000852879.1
First in ClinVar: Nov 20, 2018 Last updated: Nov 20, 2018 |
|
|
Uncertain significance
(Mar 27, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Neuromuscular disease
Affected status: unknown
Allele origin:
germline
|
Johns Hopkins Genomics, Johns Hopkins University
Accession: SCV002570274.1
First in ClinVar: Sep 17, 2022 Last updated: Sep 17, 2022 |
Comment:
This RYR1 variant (rs794726982) is rare (<0.1%) in a large population dataset (gnomAD: 102/282552 total alleles; 0.036%; no homozygotes) and has been reported in ClinVar. … (more)
This RYR1 variant (rs794726982) is rare (<0.1%) in a large population dataset (gnomAD: 102/282552 total alleles; 0.036%; no homozygotes) and has been reported in ClinVar. This variant has been reported in two family members with exertional myalgia and rhabdomyolysis. This 25 bp deletion* is located in the splice donor region of intron 10. Bioinformatic analysis predicts that this variant would affect RNA splicing, although this has not been confirmed experimentally to our knowledge. Due to insufficient evidence, we consider the clinical significance of c.957+5_957+29del to be uncertain at this time. (less)
|
|
Uncertain significance
(Oct 19, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
RYR1-related disorder
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000777518.6
First in ClinVar: May 28, 2018 Last updated: Feb 07, 2023 |
Comment:
This sequence change falls in intron 10 of the RYR1 gene. It does not directly change the encoded amino acid sequence of the RYR1 protein. … (more)
This sequence change falls in intron 10 of the RYR1 gene. It does not directly change the encoded amino acid sequence of the RYR1 protein. It affects a nucleotide within the consensus splice site. This variant is present in population databases (rs752290298, gnomAD 0.06%). This variant has been observed in individual(s) with clinical features of RYR1-related conditions (PMID: 23628358; Invitae). ClinVar contains an entry for this variant (Variation ID: 193600). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. (less)
|
|
Uncertain significance
(May 24, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Revvity Omics, Revvity
Accession: SCV003812495.2
First in ClinVar: Mar 04, 2023 Last updated: Feb 04, 2024 |
|
|
Uncertain significance
(Jul 07, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Malignant hyperthermia, susceptibility to, 1
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
Molecular Genetics, Royal Melbourne Hospital
Additional submitter:
Shariant Australia, Australian Genomics
Accession: SCV004812329.1
First in ClinVar: Apr 15, 2024 Last updated: Apr 15, 2024 |
Comment:
This sequence change in RYR1 is an intronic variant located in intron 10. The highest population minor allele frequency in the population database gnomAD v2.1 … (more)
This sequence change in RYR1 is an intronic variant located in intron 10. The highest population minor allele frequency in the population database gnomAD v2.1 is 0.06% (74/128,986 alleles) in the European (non-Finnish) population. This variant has been reported in at least two families with recurrent rhabdomyolysis, and segregates with rhabdomyolysis in one of these families (PMID: 23628358, 25960145). The results from an in silico splicing predictor (SpliceAI) indicate that this variant supports neither a deleterious nor benign impact on the donor splice site of intron 10 of RYR1. Based on the classification scheme RMH Modified ACMG Guidelines v1.6.1, this variant is classified as a VARIANT OF UNCERTAIN SIGNIFICANCE. Following criteria are met: none. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Ryanodine receptor 1-related disorders: an historical perspective and proposal for a unified nomenclature. | Lawal TA | Skeletal muscle | 2020 | PMID: 33190635 |
An unusual ryanodine receptor 1 (RYR1) phenotype: Mild calf-predominant myopathy. | Jokela M | Neurology | 2019 | PMID: 30842289 |
RYR1-related myopathies: a wide spectrum of phenotypes throughout life. | Snoeck M | European journal of neurology | 2015 | PMID: 25960145 |
Mutations in RYR1 are a common cause of exertional myalgia and rhabdomyolysis. | Dlamini N | Neuromuscular disorders : NMD | 2013 | PMID: 23628358 |
Aberrant 5' splice sites in human disease genes: mutation pattern, nucleotide structure and comparison of computational tools that predict their utilization. | Buratti E | Nucleic acids research | 2007 | PMID: 17576681 |
Mutations in RYR1 in malignant hyperthermia and central core disease. | Robinson R | Human mutation | 2006 | PMID: 16917943 |
Statistical features of human exons and their flanking regions. | Zhang MQ | Human molecular genetics | 1998 | PMID: 9536098 |
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=RYR1 | - | - | - | - |
Text-mined citations for rs794726982 ...
HelpRecord last updated May 19, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.