VCV002571523.1 - ClinVar

NM_001122955.4(BSCL2):c.358_376del (p.Tyr120fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Uncertain significance

no assertion criteria provided

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001122955.4(BSCL2):c.358_376del (p.Tyr120fs)

Variation ID: 2571523 Accession: VCV002571523.1

Type and length

Deletion, 19 bp

Location

Cytogenetic: 11q12.3 11: 62705329-62705347 (GRCh38) [ NCBI UCSC ] 11: 62472801-62472819 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Jul 17, 2023	Jul 16, 2023	Jan 6, 2016

HGVS

Nucleotide	Protein	Molecular consequence
NM_001122955.4:c.358_376del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001116427.1:p.Tyr120fs	frameshift
NM_001130702.2:c.166_184del	NP_001124174.2:p.Tyr56fs	frameshift
NM_001386027.1:c.358_376del	NP_001372956.1:p.Tyr120fs	frameshift
NM_001386028.1:c.358_376del	NP_001372957.1:p.Tyr120fs	frameshift
NM_032667.6:c.166_184del	NP_116056.3:p.Tyr56fs	frameshift
NM_032667.6:c.166_184del19		frameshift
NR_037946.1:n.2878_2896del		non-coding transcript variant
NR_037948.1:n.958_976del19
NR_037949.1:n.958_976del19
NC_000011.10:g.62705331_62705349del
NC_000011.9:g.62472803_62472821del
NG_008461.1:g.9228_9246del
LRG_235:g.9228_9246del
LRG_235t1:c.356_374del19	LRG_235p1:p.Tyr120Thrfs
LRG_235t2:c.166_184del	LRG_235p2:p.Tyr56fs

... more HGVS ... less HGVS

Protein change

Y120fs, Y56fs

Other names

Canonical SPDI

NC_000011.10:62705328:GGCTGACTGTCGGCATATAGG:GG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
BSCL2		-	-	GRCh38 GRCh37	8	574
HNRNPUL2-BSCL2	-	-	-	GRCh38	-	604

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Berardinelli-Seip congenital lipodystrophy	Uncertain significance (1)	no assertion criteria provided	Jan 6, 2016	RCV003312923.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Uncertain significance (Jan 06, 2016)	no assertion criteria provided Method: literature only	Berardinelli-Seip congenital lipodystrophy Affected status: yes Allele origin: germline	Inherited Neuropathy Consortium Ii, University Of Miami Accession: SCV004011960.1 First in ClinVar: Jul 16, 2023 Last updated: Jul 16, 2023	Publications: PubMed (1) PubMed: 14557463

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Phenotypic and genetic heterogeneity in congenital generalized lipodystrophy.	Agarwal AK	The Journal of clinical endocrinology and metabolism	2003	PMID: 14557463

Text-mined citations for this variant ...

Record last updated Nov 11, 2023

ClinVar Genomic variation as it relates to human health

NM_001122955.4(BSCL2):c.358_376del (p.Tyr120fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...