VCV002585565.2 - ClinVar

NM_001130987.2(DYSF):c.5265_5280del (p.Val1754_Tyr1755insTer)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(2)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001130987.2(DYSF):c.5265_5280del (p.Val1754_Tyr1755insTer)

Variation ID: 2585565 Accession: VCV002585565.2

Type and length

Deletion, 16 bp

Location

Cytogenetic: 2p13.2 2: 71665247-71665262 (GRCh38) [ NCBI UCSC ] 2: 71892377-71892392 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Oct 28, 2023	Dec 30, 2023	Feb 3, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_001130987.2:c.5265_5280del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001124459.1:p.Val1754_Tyr1755insTer	nonsense
NM_003494.4:c.5148_5163del MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_003485.1:p.Val1715_Tyr1716insTer	nonsense
NM_001130455.2:c.5151_5166del	NP_001123927.1:p.Val1716_Tyr1717insTer	nonsense
NM_001130976.2:c.5106_5121del	NP_001124448.1:p.Val1701_Tyr1702insTer	nonsense
NM_001130977.2:c.5169_5184del	NP_001124449.1:p.Val1722_Tyr1723insTer	nonsense
NM_001130978.2:c.5211_5226del	NP_001124450.1:p.Val1736_Tyr1737insTer	nonsense
NM_001130979.2:c.5241_5256del	NP_001124451.1:p.Val1746_Tyr1747insTer	nonsense
NM_001130980.2:c.5199_5214del	NP_001124452.1:p.Val1732_Tyr1733insTer	nonsense
NM_001130981.2:c.5262_5277del	NP_001124453.1:p.Val1753_Tyr1754insTer	nonsense
NM_001130982.2:c.5244_5259del	NP_001124454.1:p.Val1747_Tyr1748insTer	nonsense
NM_001130983.2:c.5214_5229del	NP_001124455.1:p.Val1737_Tyr1738insTer	nonsense
NM_001130984.2:c.5172_5187del	NP_001124456.1:p.Val1723_Tyr1724insTer	nonsense
NM_001130985.2:c.5202_5217del	NP_001124457.1:p.Val1733_Tyr1734insTer	nonsense
NM_001130986.2:c.5109_5124del	NP_001124458.1:p.Val1702_Tyr1703insTer	nonsense
NC_000002.12:g.71665252_71665267del
NC_000002.11:g.71892382_71892397del
NG_008694.1:g.216630_216645del
LRG_845:g.216630_216645del
LRG_845t1:c.5148_5163del	LRG_845p1:p.Val1715_Tyr1716insTer
LRG_845t2:c.5265_5280del	LRG_845p2:p.Val1754_Tyr1755insTer

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000002.12:71665246:GTGTACCGGACAGACCGTGTA:GTGTA

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
DYSF		-	-	GRCh38 GRCh37	4062	4111

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Autosomal recessive limb-girdle muscular dystrophy type 2B	Likely pathogenic (1)	criteria provided, single submitter	-	RCV003338182.2
Miyoshi muscular dystrophy 1	Likely pathogenic (1)	criteria provided, single submitter	Feb 3, 2023	RCV003466068.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (-)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Autosomal recessive limb-girdle muscular dystrophy type 2B (Autosomal recessive inheritance) Affected status: yes Allele origin: germline	Neuberg Centre For Genomic Medicine, NCGM Accession: SCV004047173.1 First in ClinVar: Oct 28, 2023 Last updated: Oct 28, 2023	Comment: The frame shift c.5265_5280del (p.Tyr1755Ter) variant in DYSF gene has not been reported previously as a pathogenic variant nor as a benign variant, to our … (more) The frame shift c.5265_5280del (p.Tyr1755Ter) variant in DYSF gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The p.Tyr1755Ter variant is novel (not in any individuals) in gnomAD Exomes and is novel (not in any individuals) in 1000 Genomes. This variant is predicted to cause loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease causing. For these reasons, this variant has been classified as Likely Pathogenic. (less) Clinical Features: Difficulty climbing stairs (present) , Hip pain (present) , Frequent falls (present)
Likely pathogenic (Feb 03, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Miyoshi muscular dystrophy 1 Affected status: unknown Allele origin: unknown	Baylor Genetics Accession: SCV004192259.1 First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023

Comment:

The frame shift c.5265_5280del (p.Tyr1755Ter) variant in DYSF gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The p.Tyr1755Ter variant is novel (not in any individuals) in gnomAD Exomes and is novel (not in any individuals) in 1000 Genomes. This variant is predicted to cause loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease causing. For these reasons, this variant has been classified as Likely Pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Apr 06, 2024

ClinVar Genomic variation as it relates to human health

NM_001130987.2(DYSF):c.5265_5280del (p.Val1754_Tyr1755insTer)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...