In silico analysis, which includes protein predictors and evolutionary conservation, supports a deleterious effect; In-frame deletion of 6 amino acids in a non-repeat region; Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 26345974, 20979233, 11279189, 31924237, 31796081, 30394555, 27305980, 9736768)
ClinVar Genomic variation as it relates to human health
NC_000023.11:g.70027902_70027919del
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(9)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
9
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NC_000023.11:g.70027902_70027919del
Variation ID: 44200 Accession: VCV000044200.40
- Type and length
-
Deletion, 18 bp
- Location
-
Cytogenetic: Xq13.1 X: 70027889-70027906 (GRCh38) [ NCBI UCSC ] X: 69247752-69247769 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jan 30, 2015 Oct 20, 2024 Jan 29, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_001399.5:c.572_589del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001390.1:p.188_190PGP[1] NM_001005609.2:c.572_589del NP_001005609.1:p.188_190PGP[1] NM_001005612.3:c.572_589del NP_001005612.2:p.188_190PGP[1] NC_000023.11:g.70027902_70027919del NC_000023.10:g.69247752_69247769del NG_009809.2:g.416836_416853del - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000023.11:70027888:CCTCCAGGACCCCCAGGACCTCCAGGACCCC:CCTCCAGGACCCC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| EDA | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
587 | 728 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
May 1, 2021 | RCV000481357.23 | |
| Pathogenic (6) |
criteria provided, multiple submitters, no conflicts
|
Jan 29, 2024 | RCV000633503.19 | |
|
EDA-related disorder
|
Pathogenic (1) |
no assertion criteria provided
|
Jan 26, 2024 | RCV003904911.3 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Jan 25, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000566561.4
First in ClinVar: Apr 27, 2017 Last updated: Apr 17, 2019 |
Comment:
In silico analysis, which includes protein predictors and evolutionary conservation, supports a deleterious effect; In-frame deletion of 6 amino acids in a non-repeat region; Not … (more)
In silico analysis, which includes protein predictors and evolutionary conservation, supports a deleterious effect; In-frame deletion of 6 amino acids in a non-repeat region; Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 26345974, 20979233, 11279189, 31924237, 31796081, 30394555, 27305980, 9736768) (less)
|
|
|
Pathogenic
(Feb 08, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hypohidrotic X-linked ectodermal dysplasia
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV002103648.1
First in ClinVar: Mar 12, 2022 Last updated: Mar 12, 2022 |
Comment:
Variant summary: EDA c.572_589del18 (p.Pro191_Pro196del) results in an in-frame deletion that is predicted to remove 6 amino acids from the encoded protein. The variant was … (more)
Variant summary: EDA c.572_589del18 (p.Pro191_Pro196del) results in an in-frame deletion that is predicted to remove 6 amino acids from the encoded protein. The variant was absent in 126835 control chromosomes (gnomAD). c.572_589del18 has been reported in the literature in multiple individuals/families affected with Hypohidrotic X-Linked Ectodermal Dysplasia (e.g. Bayes_1998, Schneider_2001, Martinez-Romero_2019, Wohlfart_2020). These data indicate that the variant is very likely to be associated with disease. Three ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. (less)
|
|
|
Pathogenic
(Jan 29, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hypohidrotic X-linked ectodermal dysplasia
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000754739.8
First in ClinVar: May 28, 2018 Last updated: Feb 14, 2024 |
Comment:
This variant, c.572_589del, results in the deletion of 6 amino acid(s) of the EDA protein (p.Pro191_Pro196del), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.572_589del, results in the deletion of 6 amino acid(s) of the EDA protein (p.Pro191_Pro196del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with hypohidrotic ectodermal dysplasia (PMID: 9736768, 11279189, 27305980). In at least one individual the variant was observed to be de novo. This variant is also known as 801/814del18. ClinVar contains an entry for this variant (Variation ID: 44200). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Pathogenic
(Jan 08, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hypohidrotic X-linked ectodermal dysplasia
(X-linked dominant inheritance)
Affected status: yes
Allele origin:
unknown
|
Institute of Human Genetics, University of Leipzig Medical Center
Accession: SCV004242417.1
First in ClinVar: Feb 14, 2024 Last updated: Feb 14, 2024 |
Comment:
Criteria applied: PS4,PM1,PM4,PS2_SUP,PM2_SUP
Clinical Features:
Exercise-induced rhabdomyolysis (present)
Sex: male
|
|
|
Pathogenic
(May 01, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV001746145.20
First in ClinVar: Jul 10, 2021 Last updated: Oct 20, 2024 |
Number of individuals with the variant: 2
|
|
|
Pathogenic
(Apr 10, 2012)
|
criteria provided, single submitter
Method: clinical testing
|
Hypohidrotic X-linked ectodermal dysplasia
(X-linked inheritance)
Affected status: not provided
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV000060835.5
First in ClinVar: May 03, 2013 Last updated: Jan 30, 2015 |
Comment:
The Pro191_Pro196del (EDA) has not been reported in one individual with X-linked anhidrotic ectodermal dysplasia (Bayes 1998). This variant results in an in-fra me deletion … (more)
The Pro191_Pro196del (EDA) has not been reported in one individual with X-linked anhidrotic ectodermal dysplasia (Bayes 1998). This variant results in an in-fra me deletion of 6 amino acids from the conserved Gly-X-Y repeats of the collagen subdomain of the EDA protein. Several adjacent and overlapping in-frame deletion s have been identified in patients with clinical features of X-linked hypohidrot ic ectodermal dysplasia (Bayes 1998, Cluzeau 2011, LMM unpublished data). In sum mary, this variant meets our criteria to be classified as pathogenic. (less)
Number of individuals with the variant: 2
|
|
|
Pathogenic
(Jan 26, 2024)
|
no assertion criteria provided
Method: clinical testing
|
EDA-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004723776.2
First in ClinVar: Mar 16, 2024 Last updated: Oct 08, 2024 |
Comment:
The EDA c.572_589del18 variant is predicted to result in an in-frame deletion (p.Pro191_Pro196del). This variant is also a deletion in the collagen triple helix repeat … (more)
The EDA c.572_589del18 variant is predicted to result in an in-frame deletion (p.Pro191_Pro196del). This variant is also a deletion in the collagen triple helix repeat domain of the EDA protein. This variant has been reported in patients affected with ectodermal dysplasia (Bayés et al. 1998. PubMed ID: 9736768; Wohlfart et al. 2016. PubMed ID: 27305980). Several similar deletions have also been reported to be pathogenic (Cluzeau et al. 2011. PubMed: 20979233; Schneider et al. 2011. PubMed: 21357618). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic. (less)
|
|
|
Pathogenic
(Oct 21, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Christ-Siemens-Touraine syndrome
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002087202.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
|
|
Uncertain significance
(Mar 25, 2024)
|
Flagged submission
flagged submission
Method: clinical testing
Reason: Outlier claim with insufficient supporting evidence
Source: ClinGen
|
Hypohidrotic X-linked ectodermal dysplasia
Affected status: unknown
Allele origin:
germline
|
Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center
Accession: SCV004806459.1
First in ClinVar: Apr 06, 2024 Last updated: Apr 06, 2024 |
|
|
| Flagged submissions do not contribute to the aggregate classification or review status for the variant. Learn more | |||||
Comment:
Comment:
Variant summary: EDA c.572_589del18 (p.Pro191_Pro196del) results in an in-frame deletion that is predicted to remove 6 amino acids from the encoded protein. The variant was absent in 126835 control chromosomes (gnomAD). c.572_589del18 has been reported in the literature in multiple individuals/families affected with Hypohidrotic X-Linked Ectodermal Dysplasia (e.g. Bayes_1998, Schneider_2001, Martinez-Romero_2019, Wohlfart_2020). These data indicate that the variant is very likely to be associated with disease. Three ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic.
Comment:
This variant, c.572_589del, results in the deletion of 6 amino acid(s) of the EDA protein (p.Pro191_Pro196del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with hypohidrotic ectodermal dysplasia (PMID: 9736768, 11279189, 27305980). In at least one individual the variant was observed to be de novo. This variant is also known as 801/814del18. ClinVar contains an entry for this variant (Variation ID: 44200). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. For these reasons, this variant has been classified as Pathogenic.
Comment:
Criteria applied: PS4,PM1,PM4,PS2_SUP,PM2_SUP
Comment:
The Pro191_Pro196del (EDA) has not been reported in one individual with X-linked anhidrotic ectodermal dysplasia (Bayes 1998). This variant results in an in-fra me deletion of 6 amino acids from the conserved Gly-X-Y repeats of the collagen subdomain of the EDA protein. Several adjacent and overlapping in-frame deletion s have been identified in patients with clinical features of X-linked hypohidrot ic ectodermal dysplasia (Bayes 1998, Cluzeau 2011, LMM unpublished data). In sum mary, this variant meets our criteria to be classified as pathogenic.
Comment:
The EDA c.572_589del18 variant is predicted to result in an in-frame deletion (p.Pro191_Pro196del). This variant is also a deletion in the collagen triple helix repeat domain of the EDA protein. This variant has been reported in patients affected with ectodermal dysplasia (Bayés et al. 1998. PubMed ID: 9736768; Wohlfart et al. 2016. PubMed ID: 27305980). Several similar deletions have also been reported to be pathogenic (Cluzeau et al. 2011. PubMed: 20979233; Schneider et al. 2011. PubMed: 21357618). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
In silico analysis, which includes protein predictors and evolutionary conservation, supports a deleterious effect; In-frame deletion of 6 amino acids in a non-repeat region; Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 26345974, 20979233, 11279189, 31924237, 31796081, 30394555, 27305980, 9736768)
Comment:
Variant summary: EDA c.572_589del18 (p.Pro191_Pro196del) results in an in-frame deletion that is predicted to remove 6 amino acids from the encoded protein. The variant was absent in 126835 control chromosomes (gnomAD). c.572_589del18 has been reported in the literature in multiple individuals/families affected with Hypohidrotic X-Linked Ectodermal Dysplasia (e.g. Bayes_1998, Schneider_2001, Martinez-Romero_2019, Wohlfart_2020). These data indicate that the variant is very likely to be associated with disease. Three ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic.
Comment:
This variant, c.572_589del, results in the deletion of 6 amino acid(s) of the EDA protein (p.Pro191_Pro196del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with hypohidrotic ectodermal dysplasia (PMID: 9736768, 11279189, 27305980). In at least one individual the variant was observed to be de novo. This variant is also known as 801/814del18. ClinVar contains an entry for this variant (Variation ID: 44200). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. For these reasons, this variant has been classified as Pathogenic.
Comment:
Criteria applied: PS4,PM1,PM4,PS2_SUP,PM2_SUP
Comment:
The Pro191_Pro196del (EDA) has not been reported in one individual with X-linked anhidrotic ectodermal dysplasia (Bayes 1998). This variant results in an in-fra me deletion of 6 amino acids from the conserved Gly-X-Y repeats of the collagen subdomain of the EDA protein. Several adjacent and overlapping in-frame deletion s have been identified in patients with clinical features of X-linked hypohidrot ic ectodermal dysplasia (Bayes 1998, Cluzeau 2011, LMM unpublished data). In sum mary, this variant meets our criteria to be classified as pathogenic.
Comment:
The EDA c.572_589del18 variant is predicted to result in an in-frame deletion (p.Pro191_Pro196del). This variant is also a deletion in the collagen triple helix repeat domain of the EDA protein. This variant has been reported in patients affected with ectodermal dysplasia (Bayés et al. 1998. PubMed ID: 9736768; Wohlfart et al. 2016. PubMed ID: 27305980). Several similar deletions have also been reported to be pathogenic (Cluzeau et al. 2011. PubMed: 20979233; Schneider et al. 2011. PubMed: 21357618). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. This variant is interpreted as pathogenic.
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Natural history of X-linked hypohidrotic ectodermal dysplasia: a 5-year follow-up study. | Wohlfart S | Orphanet journal of rare diseases | 2020 | PMID: 31924237 |
| EDA, EDAR, EDARADD and WNT10A allelic variants in patients with ectodermal derivative impairment in the Spanish population. | Martínez-Romero MC | Orphanet journal of rare diseases | 2019 | PMID: 31796081 |
| Mutational spectrum in 101 patients with hypohidrotic ectodermal dysplasia and breakpoint mapping in independent cases of rare genomic rearrangements. | Wohlfart S | Journal of human genetics | 2016 | PMID: 27305980 |
| Only four genes (EDA1, EDAR, EDARADD, and WNT10A) account for 90% of hypohidrotic/anhidrotic ectodermal dysplasia cases. | Cluzeau C | Human mutation | 2011 | PMID: 20979233 |
| Mutations leading to X-linked hypohidrotic ectodermal dysplasia affect three major functional domains in the tumor necrosis factor family member ectodysplasin-A. | Schneider P | The Journal of biological chemistry | 2001 | PMID: 11279189 |
| The anhidrotic ectodermal dysplasia gene (EDA) undergoes alternative splicing and encodes ectodysplasin-A with deletion mutations in collagenous repeats. | Bayés M | Human molecular genetics | 1998 | PMID: 9736768 |
Text-mined citations for rs397516668 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Oct 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.