ClinVar Genomic variation as it relates to human health
NM_023067.4(FOXL2):c.855_871dup (p.His291fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_023067.4(FOXL2):c.855_871dup (p.His291fs)
Variation ID: 4866 Accession: VCV000004866.7
- Type and length
-
Duplication, 17 bp
- Location
-
Cytogenetic: 3q22.3 3: 138945851-138945852 (GRCh38) [ NCBI UCSC ] 3: 138664693-138664694 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 5, 2015 Feb 14, 2024 Oct 15, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_023067.4:c.855_871dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_075555.1:p.His291fs frameshift NC_000003.12:g.138945863_138945879dup NC_000003.11:g.138664705_138664721dup NG_012454.1:g.6273_6289dup NG_029796.1:g.3630_3646dup LRG_1295:g.6273_6289dup LRG_1295t1:c.855_871dup LRG_1295p1:p.His291fs - Protein change
- H291fs
- Other names
- -
- Canonical SPDI
- NC_000003.12:138945851:GGGGGTGCGGCGGAGGCGGGGGTGCGGC:GGGGGTGCGGCGGAGGCGGGGGTGCGGCGGAGGCGGGGGTGCGGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Comment on variant
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
FOXL2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
232 | 267 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
no assertion criteria provided
|
Sep 1, 2003 | RCV000005142.4 | |
Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Jan 1, 2018 | RCV000192040.4 | |
Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Oct 15, 2023 | RCV000599160.4 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Nov 03, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia
Accession: SCV000484898.1
First in ClinVar: Oct 05, 2015 Last updated: Oct 05, 2015
Comment:
Clinical Testing
|
Number of individuals with the variant: 10
|
|
Pathogenic
(Jan 01, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
unknown,
de novo,
paternal
|
Wessex Regional Genetics Laboratory, Salisbury District Hospital
Accession: SCV000924443.1
First in ClinVar: Jun 23, 2019 Last updated: Jun 23, 2019 |
Observation 1:
Number of individuals with the variant: 1
Observation 2:
Number of individuals with the variant: 1
Observation 3:
Number of individuals with the variant: 1
Observation 4:
Number of individuals with the variant: 1
Observation 5:
Number of individuals with the variant: 1
Observation 6:
Number of individuals with the variant: 1
Observation 7:
Number of individuals with the variant: 1
Observation 8:
Number of individuals with the variant: 1
Observation 9:
Number of individuals with the variant: 1
Observation 10:
Number of individuals with the variant: 1
Observation 11:
Number of individuals with the variant: 1
Observation 12:
Number of individuals with the variant: 1
|
|
Pathogenic
(Oct 15, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV003525289.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 14, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.His291Argfs*71) in the FOXL2 gene. While this is not anticipated to result in nonsense mediated decay, … (more)
This sequence change creates a premature translational stop signal (p.His291Argfs*71) in the FOXL2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 86 amino acid(s) of the FOXL2 protein. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This premature translational stop signal has been observed in individuals with blepharophimosis-ptosis-epicanthus inversus syndrome (PMID: 11175783, 28849110, 31048069). It has also been observed to segregate with disease in related individuals. This variant is also known as 1092_1108dup and c.844_860dup17. ClinVar contains an entry for this variant (Variation ID: 4866). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Pathogenic
(Jun 29, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000710655.3
First in ClinVar: Apr 02, 2018 Last updated: Jul 08, 2023 |
Comment:
Reported previously, using alternate nomenclature of 1092-1108dup17 or c.844_860dup17, in multiple individuals from at least two families affected with blepharophimosis, ptosis, epicanthus inversus syndrome (Crisponi … (more)
Reported previously, using alternate nomenclature of 1092-1108dup17 or c.844_860dup17, in multiple individuals from at least two families affected with blepharophimosis, ptosis, epicanthus inversus syndrome (Crisponi et al., 2001; Yang et al., 2017).; Frameshift variant predicted to result in protein truncation in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 28849110, 31048069, 31077882, 32454486, 20184535, 11776388, 12938087, 36338666, 11175783) (less)
|
|
Pathogenic
(Sep 01, 2003)
|
no assertion criteria provided
Method: literature only
|
BLEPHAROPHIMOSIS, PTOSIS, AND EPICANTHUS INVERSUS, TYPE I
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000025319.3
First in ClinVar: Apr 04, 2013 Last updated: Jul 02, 2018 |
Comment on evidence:
In 3 affected members of a family with BPES type I (110100), Crisponi et al. (2001) reported a duplication of 17 bp at position 1092-1108 … (more)
In 3 affected members of a family with BPES type I (110100), Crisponi et al. (2001) reported a duplication of 17 bp at position 1092-1108 (1092_1108dup17), causing a frameshift resulting in a shorter protein. In a mutation search by direct sequencing in 9 affected individuals representing familial or sporadic cases, Udar et al. (2003) found this mutation in 3 unrelated pedigrees. There is a proline tract at this position, and the mutation results in a His291fsTer361 frameshift. A deletion mutation involving the same 17 bases was reported in a Japanese BPES patient by Yamada et al. (2001); see (605597.0007). (less)
|
|
not provided
(-)
|
no classification provided
Method: literature only
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
GeneReviews
Accession: SCV000207367.2
First in ClinVar: Oct 05, 2015 Last updated: Oct 01, 2022 |
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Blepharophimosis, Ptosis, and Epicanthus Inversus Syndrome. | Adam MP | - | 2022 | PMID: 20301614 |
Clinical characterization and identification of five novel FOXL2 pathogenic variants in a cohort of 12 Mexican subjects with the syndrome of blepharophimosis-ptosis-epicanthus inversus. | Chacón-Camacho OF | Gene | 2019 | PMID: 31048069 |
Identification of a novel FOXL2 mutation in a single family with both types of blepharophimosis‑-ptosis-epicanthus inversus syndrome. | Yang L | Molecular medicine reports | 2017 | PMID: 28849110 |
Comparative analysis of the FOXL2 gene and characterization of mutations in BPES patients. | Udar N | Human mutation | 2003 | PMID: 12938087 |
Heterozygous 17-bp deletion in the forkhead transcription factor gene, FOXL2, in a Japanese family with blepharophimosis-ptosis-epicanthus inversus syndrome. | Yamada T | Journal of human genetics | 2001 | PMID: 11776388 |
The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. | Crisponi L | Nature genetics | 2001 | PMID: 11175783 |
Text-mined citations for rs797044532 ...
HelpRecord last updated May 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.
NCBI staff reviewed the sequence information reported in PubMed 11175783 Fig. 2a to determine the location of this allele on the current reference sequence.