VCV000550382.16 - ClinVar

NM_000203.5(IDUA):c.878_889dup (p.Thr293_Tyr296dup)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(4)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_000203.5(IDUA):c.878_889dup (p.Thr293_Tyr296dup)

Variation ID: 550382 Accession: VCV000550382.16

Type and length

Duplication, 12 bp

Location

Cytogenetic: 4p16.3 4: 1002063-1002064 (GRCh38) [ NCBI UCSC ] 4: 995851-995852 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 5, 2018	Feb 14, 2024	Nov 22, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_000203.5:c.878_889dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_000194.2:p.Thr293_Tyr296dup	inframe insertion
NM_000203.4:c.878_889dup12
NM_000203.4:c.878_889dupCCCCCATTTACA
NM_001363576.1:c.482_493dup	NP_001350505.1:p.Thr161_Tyr164dup	inframe insertion
NR_110313.1:n.966_977dup		non-coding transcript variant
NC_000004.12:g.1002067_1002078dup
NC_000004.11:g.995855_995866dup
NG_008103.1:g.20071_20082dup
LRG_1277:g.20071_20082dup
LRG_1277t1:c.878_889dup	LRG_1277p1:p.Thr293_Tyr296dup

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000004.12:1002063:ACACCCCCATTTACA:ACACCCCCATTTACACCCCCATTTACA

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs779762183 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
IDUA		-	-	GRCh38 GRCh37	1390	2153

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Hurler syndrome	Likely pathogenic (1)	criteria provided, single submitter	Jan 20, 2017	RCV000665114.1
Mucopolysaccharidosis type 1	Pathogenic (3)	criteria provided, multiple submitters, no conflicts	Nov 22, 2023	RCV000794373.12

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Jan 20, 2017)	criteria provided, single submitter (Counsyl Autosomal Recessive and X-Linked Classification Criteria (2018)) Method: clinical testing	Hurler syndrome Affected status: unknown Allele origin: unknown	Counsyl Accession: SCV000789180.1 First in ClinVar: Aug 05, 2018 Last updated: Aug 05, 2018	Publications: PubMed (5) PubMed: 11735025‚ 21394825‚ 7550242‚ 12203999‚ 9787109
Pathogenic (Feb 04, 2023)	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015) Method: clinical testing	Mucopolysaccharidosis type 1 Affected status: unknown Allele origin: germline	Women's Health and Genetics/Laboratory Corporation of America, LabCorp Accession: SCV003844265.1 First in ClinVar: Mar 26, 2023 Last updated: Mar 26, 2023	Publications: PubMed (5) PubMed: 21394825‚ 24875751‚ 23786846‚ 7550242‚ 28752568 Comment: Variant summary: IDUA c.878_889dup12 (p.Thr293_Tyr296dup) results in an in-frame duplication that is predicted to duplicate 4 amino acids into the encoded protein. The variant allele … (more) Variant summary: IDUA c.878_889dup12 (p.Thr293_Tyr296dup) results in an in-frame duplication that is predicted to duplicate 4 amino acids into the encoded protein. The variant allele was found at a frequency of 6.6e-06 in 150926 control chromosomes (gnomAD v3.1.2). c.878_889dup12 has been reported in the literature as a biallelic genotype in multiple individuals affected with Mucopolysaccharidosis Type 1 (e.g. Bunge_1995, Bertola_2011, Chistiakov_2014, Ghosh_2017). These data indicate that the variant is very likely to be associated with disease. Residual IDUA activity was 0.9% in cells from a compound heterozygous individual that carried a null variant in trans, indicating this variant also results in loss of function (Oussoren_2013). Three ClinVar submitters have assessed the variant since 2014: one classified the variant as likely pathogenic, and two as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. (less)
Pathogenic (Nov 22, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Mucopolysaccharidosis type 1 Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000933778.6 First in ClinVar: Aug 14, 2019 Last updated: Feb 14, 2024	Publications: PubMed (5) PubMed: 9787109‚ 12203999‚ 21394825‚ 23786846‚ 11735025 Comment: This variant, c.878_889dup, results in the insertion of 4 amino acid(s) of the IDUA protein (p.Thr293_Tyr296dup), but otherwise preserves the integrity of the reading frame. … (more) This variant, c.878_889dup, results in the insertion of 4 amino acid(s) of the IDUA protein (p.Thr293_Tyr296dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with mucopolysaccharidosis (MPS) type I (PMID: 9787109, 12203999, 21394825, 23786846; Invitae). ClinVar contains an entry for this variant (Variation ID: 550382). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects IDUA function (PMID: 11735025). For these reasons, this variant has been classified as Pathogenic. (less)
Pathogenic (Aug 14, 2020)	no assertion criteria provided Method: clinical testing	Mucopolysaccharidosis type I Affected status: unknown Allele origin: germline	Natera, Inc. Accession: SCV002075318.1 First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022

Comment:

Variant summary: IDUA c.878_889dup12 (p.Thr293_Tyr296dup) results in an in-frame duplication that is predicted to duplicate 4 amino acids into the encoded protein. The variant allele was found at a frequency of 6.6e-06 in 150926 control chromosomes (gnomAD v3.1.2). c.878_889dup12 has been reported in the literature as a biallelic genotype in multiple individuals affected with Mucopolysaccharidosis Type 1 (e.g. Bunge_1995, Bertola_2011, Chistiakov_2014, Ghosh_2017). These data indicate that the variant is very likely to be associated with disease. Residual IDUA activity was 0.9% in cells from a compound heterozygous individual that carried a null variant in trans, indicating this variant also results in loss of function (Oussoren_2013). Three ClinVar submitters have assessed the variant since 2014: one classified the variant as likely pathogenic, and two as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic.

Comment:

This variant, c.878_889dup, results in the insertion of 4 amino acid(s) of the IDUA protein (p.Thr293_Tyr296dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with mucopolysaccharidosis (MPS) type I (PMID: 9787109, 12203999, 21394825, 23786846; Invitae). ClinVar contains an entry for this variant (Variation ID: 550382). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects IDUA function (PMID: 11735025). For these reasons, this variant has been classified as Pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
IDUA mutational profile and genotype-phenotype relationships in UK patients with Mucopolysaccharidosis Type I.	Ghosh A	Human mutation	2017	PMID: 28752568
Molecular characteristics of patients with glycosaminoglycan storage disorders in Russia.	Chistiakov DA	Clinica chimica acta; international journal of clinical chemistry	2014	PMID: 24875751
Residual α-L-iduronidase activity in fibroblasts of mild to severe Mucopolysaccharidosis type I patients.	Oussoren E	Molecular genetics and metabolism	2013	PMID: 23786846
IDUA mutational profiling of a cohort of 102 European patients with mucopolysaccharidosis type I: identification and characterization of 35 novel α-L-iduronidase (IDUA) alleles.	Bertola F	Human mutation	2011	PMID: 21394825
Molecular analysis of 30 mucopolysaccharidosis type I patients: evaluation of the mutational spectrum in Italian population and identification of 13 novel mutations.	Venturi N	Human mutation	2002	PMID: 12203999
Mutational analysis of 85 mucopolysaccharidosis type I families: frequency of known mutations, identification of 17 novel mutations and in vitro expression of missense mutations.	Beesley CE	Human genetics	2001	PMID: 11735025
Molecular genetics of mucopolysaccharidosis type I: mutation analysis among the patients of the former Soviet Union.	Voskoboeva EY	Molecular genetics and metabolism	1998	PMID: 9787109
Mucopolysaccharidosis type I: identification of 13 novel mutations of the alpha-L-iduronidase gene.	Bunge S	Human mutation	1995	PMID: 7550242

Text-mined citations for rs779762183 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_000203.5(IDUA):c.878_889dup (p.Thr293_Tyr296dup)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs779762183 ...