U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

US3 serine/threonine protein kinase US3 [ Suid alphaherpesvirus 1 ]

Gene ID: 2952561, updated on 20-Nov-2023

Summary

Go to the top of the page Help
Gene symbol
US3
Gene description
serine/threonine protein kinase US3
Locus tag
SuHV1_gp65
Gene type
protein coding
RefSeq status
PROVISIONAL
Organism
Suid alphaherpesvirus 1 (strain: Composite of 6 strains, acronym: PRV, acronym: SuHV-1, nat-host: Sus scrofa)
Lineage
Viruses; Duplodnaviria; Heunggongvirae; Peploviricota; Herviviricetes; Herpesvirales; Herpesviridae; Alphaherpesvirinae; Varicellovirus
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

Go to the top of the page Help
Sequence:
NC_006151.1 (118239..120956)

NC_006151.1Genomic Context describing neighboring genes Neighboring gene miscRNA Neighboring gene transcriptional regulator ICP4 Neighboring gene regulatory protein ICP22 Neighboring gene envelope glycoprotein G Neighboring gene envelope glycoprotein D Neighboring gene envelope glycoprotein I Neighboring gene envelope glycoprotein E Neighboring gene membrane protein US9 Neighboring gene virion protein US2

Genomic regions, transcripts, and products

Go to the top of the page Help
Genomic Sequence:
NC_006151.1

Go to nucleotide: Graphics FASTA GenBank

Bibliography

Go to the top of the pageHelp

Related articles in PubMed

  1. A Pseudorabies Virus Serine/Threonine Kinase, US3, Promotes Retrograde Transport in Axons via Akt/mToRC1. Esteves AD, et al. J Virol, 2022 Mar 9. PMID 34985995, Free PMC Article
  2. Roles of the Different Isoforms of the Pseudorabies Virus Protein Kinase pUS3 in Nuclear Egress. Sehl J, et al. J Virol, 2020 Mar 17. PMID 31941788, Free PMC Article
  3. The US3 Protein of Pseudorabies Virus Drives Viral Passage across the Basement Membrane in Porcine Respiratory Mucosa Explants. Lamote JAS, et al. J Virol, 2016 Dec 1. PMID 27681139, Free PMC Article
  4. Alphaherpesviral US3 kinase induces cofilin dephosphorylation to reorganize the actin cytoskeleton. Jacob T, et al. J Virol, 2013 Apr. PMID 23365433, Free PMC Article
  5. Pseudorabies virus US3-mediated inhibition of apoptosis does not affect infectious virus production. Deruelle MJ, et al. J Gen Virol, 2010 May. PMID 20053819

See all (10) citations in PubMed

GeneRIFs: Gene References Into Functions

What's a GeneRIF?
  1. A Pseudorabies Virus Serine/Threonine Kinase, US3, Promotes Retrograde Transport in Axons via Akt/mToRC1.
    Title: A Pseudorabies Virus Serine/Threonine Kinase, US3, Promotes Retrograde Transport in Axons via Akt/mToRC1.
  2. Roles of the Different Isoforms of the Pseudorabies Virus Protein Kinase pUS3 in Nuclear Egress.
    Title: Roles of the Different Isoforms of the Pseudorabies Virus Protein Kinase pUS3 in Nuclear Egress.
  3. In ex vivo porcine respiratory mucosa explants, we show that the conserved US3 protein of the porcine alphaherpesvirus pseudorabies virus (PRV) is critical for passage of PRV across the basement membrane and contributes to efficient viral epithelial spread.
    Title: The US3 Protein of Pseudorabies Virus Drives Viral Passage across the Basement Membrane in Porcine Respiratory Mucosa Explants.
  4. US3 protein kinase of pseudorabies virus triggers the binding of the inhibitory natural killer cell receptor CD300a to the surface of the infected cell, and protects of virus infected cells against natural killer cell-mediated lysis.
    Title: Pseudorabies Virus US3 Protein Kinase Protects Infected Cells from NK Cell-Mediated Lysis via Increased Binding of the Inhibitory NK Cell Receptor CD300a.
  5. Pseudorabies virus US3 expression led to RhoA phosphorylation at serine 188 to induce actin rearrangements.
    Title: Pseudorabies virus US3 triggers RhoA phosphorylation to reorganize the actin cytoskeleton.
  6. US3 kinase of Pseudorabies virus leads to activation (dephosphorylation) of cofilin, and cofilin contributes to US3-mediated actin rearrangements.
    Title: Alphaherpesviral US3 kinase induces cofilin dephosphorylation to reorganize the actin cytoskeleton.
  7. These results show that PAK1 plays a significant, yet limited, role in the anti-apoptotic activity of pseudorabies virus US3 protein.
    Title: Role of group A p21-activated kinases in the anti-apoptotic activity of the pseudorabies virus US3 protein kinase.
  8. Inhibition of apoptosis did not affect US3null or wild-type pseudorabies virus extracellular or cell-associated virus titres, nor did it restore the small plaque phenotype of US3null pseudorabies virus.
    Title: Pseudorabies virus US3-mediated inhibition of apoptosis does not affect infectious virus production.
  9. These results suggest that the kinase activity of the US3 protein of PRV is crucial to protect cells from apoptotic cell death during infection partly by leading to phosphorylation of the pro-apoptotic Bad protein.
    Title: A point mutation in the putative ATP binding site of the pseudorabies virus US3 protein kinase prevents Bad phosphorylation and cell survival following apoptosis induction.
Submit: New GeneRIF Correction

General gene information

Go to the top of the page Help

Homology

Miscellaneous features

  • Loc: 118266-118266 experiment = approximation (+/- 5 nt) of transcriptional initation site from S1 mapping in strain NIA-3
  • Loc: 118268-118268 transcriptional initiation site inference = ab initio prediction:NNPP:
  • Loc: 119363-119363 transcriptional initiation site inference = ab initio prediction:NNPP:

regulatory

  • Loc: 118239-118245 inference = ab initio prediction:TRANSFACFind: , regulatory_class = TATA_box
  • Loc: 119332-119338 inference = ab initio prediction:TRANSFACFind: , regulatory_class = TATA_box
  • Loc: 120951-120956 experiment = consistent with mRNA size (sense unknown) in strain Ka (US4) , experiment = consistent with mRNA size and sense in strain NIA-3 (US3) , experiment = consistent with mRNA sizes and sense in strain Ka , inference = ab initio prediction:PolyADQ: , regulatory_class = polyA_signal_sequence

Repeated regions

  • Loc: 120218-120378 rpt_type = direct , rpt_unit_seq = gagctgacctccagcgacctcgacaacatcgagatcgaggtcgtgggctctcccgccgctcccgccgagggcccggcgacggaggaggggcgcggggccgaggaggacgag

General protein information

Go to the top of the page Help
Preferred Names
serine/threonine protein kinase US3
YP_068384.2
  • PK family

NCBI Reference Sequences (RefSeq)

Go to the top of the page Help

NEW Try the new Transcript table

Genome Annotation

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference assembly

Genomic

  1. NC_006151.1 Reference assembly

    Range
    118239..120956
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

mRNA and Protein(s)

  1. YP_068384.2 serine/threonine protein kinase US3 [Suid alphaherpesvirus 1]

    See identical proteins and their annotated locations for YP_068384.2

    Status: PROVISIONAL

    UniProtKB/Swiss-Prot
    P17613
    UniProtKB/TrEMBL
    A0A0S2MM84, G3G920, Q5PP76
    Conserved Domains (3) summary
    PHA03209
    Location:1 → 334
    PHA03209; serine/threonine kinase US3; Provisional
    cd00180
    Location:61 → 233
    PKc; Catalytic domain of Protein Kinases
    cl21453
    Location:149 → 328
    PKc_like; Protein Kinases, catalytic domain
Nucleotide Protein
Heading Accession and Version

Gene LinkOut

The following LinkOut resources are supplied by external providers. These providers are responsible for maintaining the links.