|
| Status |
Public on Aug 09, 2019 |
| Title |
RNAseq_dNxf2_het_Panx_FL10B_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
ovary
|
| Organism |
Drosophila melanogaster |
| Characteristics |
age: 3-5 old
tissue: ovary
genotype: nxf2 +/-, panx FL10B tethered
|
| Treatment protocol |
Flies were fed with yeast. Germline specific knockdowns were done as described (Czech et al., 2013 Mol Cell). CRISPR/Cas9 mediated generation of dNxf2 mutants and Panx mutants were done as described (Port et al., 2014 PNAS).
|
| Growth protocol |
All fly stocks were maintained at 25°C on standard diet.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was prepared with Trizol reagent (Invitrogen), Transcriptome libraries were prepared according (Armour et al. 2009, Nat Methods) using not-so-random priming (NSR). 1 ug total RNA was revere transcribed using SuperScript III enzyme with first-strand NSR primer. RNA template was removed with RNase H (Invitrogen). Then cDNA was mixed with exo-Klenow fragment (NEB) second-strand NSR primer to synthesize the second strand. For PCR amplification, purified second-strand synthesis reaction were mixed with LA Taq Version 2.0 (Takara) and P5-SBS3T-NSR and P7-SBS8N-NSR primers. Products were run on a 2% low-melt agarose gel, and the 250–500 bp range were purified.
RNA-seq was performed as described (Vagin et al., 2013 RNA and Armour et al., 2009 Nat Methods). Samples were sequenced on Illumina platforms with HiSeq X Ten.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
RNAseq_gene.count.txt
|
| Data processing |
Basecalls were performed using bcl2fastq v1.8.4 for Illumina HiSeq 2500 and HiSeq X Ten output.
RNA-seq reads (single-end reads or read1 for paired-end reads) were processed using Cutadapt (v1.16) . The adapter sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and low-quality bases were trimmed from the 3’ end of reads, and reads short than 20 bp were discarded.
RNA-seq reads were aligned to UCSC dm3 using STAR (v2.5.2a), only uniquely mapped reads were retained.
To create RNA-seq coverage plots, the mapped RNA-seq reads were split according to strand, renormalized (to reads per million, rpm) and reformatted in the bigWig file format.
Genome_build: dm3
Supplementary_files_format_and_content: bigWig files
|
| |
|
| Submission date |
Apr 18, 2019 |
| Last update date |
Aug 10, 2019 |
| Contact name |
Ming Wang |
| E-mail(s) |
wangming@ibp.ac.cn
|
| Phone |
01064881022
|
| Organization name |
Institute of Biophysics, Chinese Academy of Sciences
|
| Department |
Key Laboratory of RNA Biology
|
| Lab |
Yang Yu
|
| Street address |
#15 Datun Road, Chaoyang, Beijing 100101, China
|
| City |
Beijing |
| State/province |
Beijing |
| ZIP/Postal code |
100101 |
| Country |
China |
| |
|
| Platform ID |
GPL23702 |
| Series (2) |
| GSE121158 |
A Pandas complex adapted for piRNA-guided transposon silencing (RNA-seq) |
| GSE130042 |
A Pandas complex adapted for piRNA-guided transposon silencing and heterochromatin formation |
|
| Relations |
| BioSample |
SAMN11463383 |
| SRA |
SRX5709937 |
