 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 20, 2022 |
| Title |
RNA-Seq from Mod(mdg4)-All-KD rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Mod(mdg4)-All-KD OSC
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell type: Ovarian Somatic Cells (OSC)
treatment: RNAi Mod(mdg4)-All
tissue: n/a
genotype: n/a
|
| Growth protocol |
Cells were grown at 26 degrees on OSC medium (Fly Extract added M3 medium).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs were isolated with the Isogen II reagent (NipponGene). Poly(A)+ RNAs were obtained using Oligo-dT beads. Libraries are prepared with illumine TruSeq stranded mRNA kit according to manufacturer’s protocol.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
Sample 37
|
| Data processing |
RNA-Seq: Reads of mRNA were mapped to dm6 by RSEM and STAR using following parameter (rsem-calculate-expression --paired-end -p 8 --star --star-path ~/anaconda3/bin --gzipped-read-file). DEG were detected by limma. For analysis of transposable elements, reads were mapped to dm6 using following parameter (--runMode genomeGenerate --genomeDir ${path_to_index} --genomeSAindexNbases 12 --genomeFastaFiles ${path_to_fasta}).
ChIP-Seq: Adaptors added by NEBNext Ultra II were cut by cutadapt using following parameters (cutadapt -j 12 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -m 20 -o trim/${name2}_R1_trim.fastq.gz -p trim/${name2}_R2_trim.fastq.gz raw_file/${name2}_R1.fastq.gz raw_file/${name2}_R2.fastq.gz). For mapping to the genome, subsequent reads were mapped to the dm6 by bowtie2 using following parameters (bowtie2 -p 16 -x ${reference}/dm6 -N 1 -1 trim/${name2}_R1_trim.fastq.gz -2 trim/${name2}_R2_trim.fastq.gz -S sam_file/${name2}.sam). Peak call is performed by MACS using following parameter: for Mod(mdg4) isoforms(macs2 callpeak -t merge_file/Ty-AF_merge.sort.bam -c bam_file/Input-AF.sort.bam -n Ty-AF -f BAM -q 1e-15 -g dm --outdir peakcall_strict) and for PolII(macs2 callpeak -t ${item} -c ../bam_file/Input_All.sort.bam -n ${item%%.bam} -f BAM -g dm --outdir ../peakcall).
Micro-C XL: Distiller (https://github.com/open2c/distiller-nf) pipeline is used to process Micro-C datasets. First, sequencing reads were mapped to dm6 using bwa mem with flags-SP. Second, mapped reads were parsed and classified using the pairtools package (https://github.com/open2c/pairtools) to get cool file. PCR and/optical duplicates removed by matching the positions of aligned reads with 2bp flexibility. Next, pairs were filtered using mapping quality scores (MAPQ > 30) on each side of aligned chimeric read, binned into multiple resolutions and low coverage bins are removed. Finally multiresolution cooler files were created using the cooler package (https://github.com/open2c/cooler.git)(Abdennur and Mirny, 2019). We normalized contact matrices using the iterative correction procedure(Imakaev et al., 2012).
Genome_build: dm6
Supplementary_files_format_and_content: RNA-Seq: TPM and FPKM of each genes (flybase ID)
Supplementary_files_format_and_content: ChIP-Seq: bigwig file
Supplementary_files_format_and_content: Micro-C XL: multi-resolution cooler file
|
| |
|
| Submission date |
Jun 04, 2021 |
| Last update date |
Oct 20, 2022 |
| Contact name |
Chikara Takeuchi |
| E-mail(s) |
chikarabs52@keio.jp
|
| Organization name |
Keio University
|
| Department |
Molecular biology
|
| Lab |
Siomi lab
|
| Street address |
35 Shinanomachi
|
| City |
Shinjuku-ku |
| State/province |
Tokyo |
| ZIP/Postal code |
162-8582 |
| Country |
Japan |
| |
|
| Platform ID |
GPL23702 |
| Series (1) |
| GSE176196 |
Mod(mdg4) variants repress telomeric retrotransposon Het-A by blocking subtelomeric enhancers |
|
| Relations |
| BioSample |
SAMN19573316 |
| SRA |
SRX11071588 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5359818_All_1.genes.results.txt.gz |
350.8 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
