|
| Status |
Public on Jun 09, 2010 |
| Title |
GFP-KD-1 (total RNA) |
| Sample type |
RNA |
| |
|
| Source name |
HeLa cells control
|
| Organism |
Homo sapiens |
| Characteristics |
treatment protocol: control
|
| Treatment protocol |
HeLa cells were cotransfected (Lipofectamine; Invitrogen) with 5 μg of shRNA expression plasmid and 20 ng of pBabe-puromycin plasmid. BRCA1 shRNA (gccacaggaccccaagaaugag) was targeted to the 3’- untranslated region of the BRCA1 mRNA. The control shRNA was targeted against a mutant GFP construct (gggccauggcacguacggcaag). Puromycin selection (2 μg/ml) was applied 24 h after transfection, and cells were harvested at 72 h post transfection.
|
| Growth protocol |
HeLa cell line was maintained in DMEM media supplemented with 10% Bovine Serum, 100 I.U./ml Penicillin, 100 μg/ml Streptomycin in a humidified incubator at 37 C and 5% CO2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was prepared with Tri Reagent (Molecular Research) and further purified over RNeasy columns (Qiagen); mRNA was prepared using Dynabeads mRNA direct kit (Invitrogen)
|
| Label |
biotin
|
| Label protocol |
Biotinylated cRNA was prepared according to the standard Affymetrix protocol from 2 ug total RNA (Expression Analysis Technical Manual, 2007, Affymetrix).
|
| |
|
| Hybridization protocol |
Following fragmentation, 15 ug of cRNA was hybridized for 16 hours at 45ºC on Human Genome U133 Plus 2.0 GeneChips. GeneChips were washed and stained in the Affymetrix Fluidics Station 460.
|
| Scan protocol |
GeneChips were scanned using the Affymetrix GeneChip Scanner 3000 7G.
|
| Description |
Total RNA
Gene expression data of HeLa cells
|
| Data processing |
The data were analyzed with Expression Console software (version 1.1.2) using Affymetrix default analysis settings and MAS5 algorithm.
|
| |
|
| Submission date |
Jun 09, 2010 |
| Last update date |
Jun 09, 2010 |
| Contact name |
Ekaterina Lamber |
| Organization name |
Ohio State University
|
| Department |
Biomedical Informatics
|
| Lab |
Prof Parvin
|
| Street address |
904 BRT, 460 W. 12th Avenue
|
| City |
Columbus |
| State/province |
OH |
| ZIP/Postal code |
43210 |
| Country |
USA |
| |
|
| Platform ID |
GPL570 |
| Series (1) |
| GSE22259 |
BRCA1 depletion effect on HeLa cells |
|
