GEO Profile Links for Gene (Select 15388) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2201

<< First< Prev

Page of 111

Next >Last >>

Select item 1222669941.

Hnrnpl - TRPM7 deficiency effect on embryonic stem cells

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2627690 (ID_REF), GDS5325, NM_177301, HNRPL (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 122266994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1213200762.

Hnrnpl - Restless Legs Syndrome model: embryonic forebrain

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2627690 (ID_REF), GDS5300, NM_177301

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 121320076

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1312509943.

Hnrnpl - Snail transcription factor/ERα ligand-binding region chimeric protein effect on embryonic stem cells: time course

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2627690 (ID_REF), GDS5807, NM_177301, HNRPL (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131250994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1248252764.

Hnrnpl - DPP4A overexpression effect on fibroblast cell line

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2627690 (ID_REF), GDS5400, NM_177301

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124825276

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 616219945.

Hnrnpl - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2627690 (ID_REF), GDS3582, NM_177301, HNRPL (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61621994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74773996.

Hnrnpl - MPSS transcriptome analysis project

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCGATGAACTGGGAG (ID_REF), GDS868, NM_177301

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7477399

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299949767.

Hnrnpl - Lymphotoxin-β receptor agonist antibody effect on lipopolysaccharide-stimulated embryonic fibroblasts

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2627690 (ID_REF), GDS5655, NM_177301

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129994976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1278565368.

Hnrnpl - Rhabdomyosarcoma model

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6481, 4210593 (ID_REF), GDS5527, NM_177301, Hnrpl (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127856536

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1269021079.

Hnrnpl - Onecut1 deficiency effect on embryonic E14.5 retina

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL1261, 1424101_at (ID_REF), GDS5458, 15388 (Gene ID), BC027206

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126902107

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12626179410.

Hnrnpl - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2627690 (ID_REF), GDS5436, NM_177301, HNRPL (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126261794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12540677611.

Hnrnpl - Model for Wilms tumor of the kidney: time course

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2627690 (ID_REF), GDS5415, NM_177301

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125406776

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12129357612.

Hnrnpl - Restless Legs Syndrome model: adult whole brain

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2627690 (ID_REF), GDS5299, NM_177301

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121293576

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11141687613.

Hnrnpl - Insm1 deficiency effect on the fetal pituitary gland

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2627690 (ID_REF), GDS5066, NM_177301

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 111416876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10329509414.

Hnrnpl - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2627690 (ID_REF), GDS4795, NM_177301, HNRPL (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103295094

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9006600715.

Hnrnpl - Polycomb repressive complex 1 protein Bmi1 transduced CCE embryonic stem cells and differentiated embryoid body samples

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL1261, 1424101_at (ID_REF), GDS4211, 15388 (Gene ID), BC027206

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 90066007

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7872197616.

Hnrnpl - Human Epidermal Growth Factor Receptor 2-positive breast cancer MMTV-Her2/Neu murine model: primary and secondary mammary tumors

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2627690 (ID_REF), GDS4099, NM_177301

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 78721976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7464459417.

Hnrnpl - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2627690 (ID_REF), GDS3974, NM_177301, HNRPL (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74644594

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6257654818.

Hnrnpl - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL6333, scl32855.14.1_3-S (ID_REF), GDS3621, NM_177301, Hnrpl (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62576548

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4695024519.

Hnrnpl - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL4234, 4210593 (ID_REF), GDS3037, NM_177301

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46950245

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1914030720.

Hnrnpl - Homeobox Lim1 mutant nephron-deficient kidneys

Annotation:: Hnrnpl, heterogeneous nuclear ribonucleoprotein L

Organism:: Mus musculus

Reporter:: GPL1261, 1424101_at (ID_REF), GDS1748, 15388 (Gene ID), BC027206

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 19140307

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 111

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 15388) (2201)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2201

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity