GEO Profile Links for Gene (Select 16971) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2271

<< First< Prev

Page of 114

Next >Last >>

Select item 686840551.

Lrp1 - TNF receptor and lymphotoxin beta -receptor activation effect on aortic endothelial cells in vitro

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448655_at (ID_REF), GDS3810, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 68684055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 302319022.

Lrp1 - Vascular endothelial cell differentiation in vitro

Annotation:: Lrp1, Low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL922, 15302 (ID_REF), GDS2322, H3146C12 (CLONE ID), A_65_P04002 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 24 samples

ID:: 30231902

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 84207393.

Lrp1 - Hormone-induced adipogenesis suppressed by 2,3,7,8-tetrachlorodibenzo-p-dioxin and EGF

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL81, 101073_at (ID_REF), GDS951, 16971 (Gene ID), X67469

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 8420739

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 618742554.

Lrp1 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1442849_at (ID_REF), GDS3596, 16971 (Gene ID), AV345706

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61874255

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76088455.

Lrp1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTTGGCATAGGGCCC (ID_REF), GDS878, NM_008512

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7608845

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 414071116.

Lrp1 - Nephronophthisis model

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL2897, 126111 (ID_REF), GDS2817, NM_008512

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41407111

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 686375557.

Lrp1 - TNF receptor and lymphotoxin beta -receptor activation effect on aortic smooth muscle cells in vitro: time course

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448655_at (ID_REF), GDS3809, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 68637555

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619313558.

Lrp1 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1442849_at (ID_REF), GDS3598, 16971 (Gene ID), AV345706

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61931355

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 618800559.

Lrp1 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448655_at (ID_REF), GDS3596, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61880055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 539243910.

Lrp1 - Osteogenesis induced by bone morphogenic protein 2

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL81, 101073_at (ID_REF), GDS679, 16971 (Gene ID), X67469

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 5392439

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11851825511.

Lrp1 - Dicer deficiency effect on preadipocytes

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448655_at (ID_REF), GDS5234, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118518255

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9695954312.

Lrp1 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10373223 (ID_REF), GDS4490, NM_008512, AF367720, AK078273, AK153549, chr10:127538176-127621126 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96959543

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9965614313.

Lrp1 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10373223 (ID_REF), GDS4578, NM_008512, AF367720, AK078273, AK153549, chr10:127538176-127621126 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99656143

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3176785514.

Lrp1 - Edema toxin effect on macrophage cell line: time course

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448655_at (ID_REF), GDS2410, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 31767855

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4666005515.

Lrp1 - Bone morphogenetic protein 4 effect on a stem cell line

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448655_at (ID_REF), GDS3025, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46660055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11123215516.

Lrp1 - Zymosan-induced inflammation effect on peritoneal monocyte and macrophage populations: time course

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448655_at (ID_REF), GDS5060, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 111232155

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3946673917.

Lrp1 - Brown and white adipocyte differentiation

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL81, 101073_at (ID_REF), GDS2743, 16971 (Gene ID), X67469

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 39466739

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3042876718.

Lrp1 - Myod and Myog expression effect on myogenesis: time course

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL339, 1448655_at (ID_REF), GDS2334, 16971 (Gene ID), NM_008512

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 30428767

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4210933919.

Lrp1 - Mammary gland development

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL81, 101073_at (ID_REF), GDS2843, 16971 (Gene ID), X67469

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 42109339

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3977613920.

Lrp1 - Interferon regulatory factor-1 effect on transformed cells

Annotation:: Lrp1, low density lipoprotein receptor-related protein 1

Organism:: Mus musculus

Reporter:: GPL81, 101073_at (ID_REF), GDS2752, 16971 (Gene ID), X67469

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39776139

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 114

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 16971) (2271)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2271

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity