GEO Profile Links for Gene (Select 17089) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1324

<< First< Prev

Page of 67

Next >Last >>

Select item 967745421.

Lyar - MYBL1 transcription factor knockout effect on testes

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS4485, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 96774542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 939950422.

Lyar - Gonadal development: ovaries and testes

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS4503, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93995042

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 721675423.

Lyar - Polyubiquitin knockout effect on testis: time course

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS3906, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72167542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441620574.

Lyar - Testis response to histone deacetylase inhibitor trichostatin A: time course

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL4053, 7457 (ID_REF), GDS2923, NM_025281

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 44162057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 314305425.

Lyar - Male germ cells

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS2390, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31430542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 294310426.

Lyar - Ribonucleoprotein- and polysome-associated mRNAs of the testis: time-course

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL339, 1417511_at (ID_REF), GDS2277, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29431042

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 131192427.

Lyar - Androgen effect on spermatogenesis: time course

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL8321, 1417511_at (ID_REF), GDS1367, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 13119242

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 56496198.

Lyar - Spermatogonial stem cell activity in testis laminin binding germ cells (MG-U74B)

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL82, 108547_at (ID_REF), GDS701, 17089 (Gene ID), AW121110

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 5649619

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47739199.

Lyar - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL82, 108547_at (ID_REF), GDS606, 17089 (Gene ID), AW121110

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4773919

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 266841910.

Lyar - Spermatogenesis time course (MG-U74B)

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL82, 108547_at (ID_REF), GDS409, 17089 (Gene ID), AW121110

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2668419

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5591804211.

Lyar - Dicer deficiency effect on embryonic stem cells

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS3404, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 55918042

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4736784212.

Lyar - Various normal tissues

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS3052, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 47367842

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747781013.

Lyar - MPSS transcriptome analysis project

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGCAGGAACCCCACCT (ID_REF), GDS868, AW121110

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7477810

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 435444214.

Lyar - Sex specific transcription in somatic and reproductive tissues

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL339, 1417511_at (ID_REF), GDS565, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4354442

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10778654215.

Lyar - Telomere-associated protein Rif1 depletion effect on stem cell lines

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS4943, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 107786542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6582354216.

Lyar - Embryonic brain development

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS3442, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 65823542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5911774217.

Lyar - Transcription factor Klf5 deficiency effect on embryonic stem cells

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS3509, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 59117742

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5717961918.

Lyar - Embryonic stem cell response to STAT3 overexpression in vitro (MG-U74B)

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL82, 108547_at (ID_REF), GDS3445, 17089 (Gene ID), AW121110

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57179619

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4242374219.

Lyar - Taf7l deficiency effect on the testis

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL1261, 1417511_at (ID_REF), GDS2857, 17089 (Gene ID), NM_025281

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42423742

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3022285620.

Lyar - Vascular endothelial cell differentiation in vitro

Annotation:: Lyar, Ly1 antibody reactive clone

Organism:: Mus musculus

Reporter:: GPL922, 6256 (ID_REF), GDS2322, H3103A10 (CLONE ID), A_65_P02440 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 24 samples

ID:: 30222856

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 67

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 17089) (1324)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1324

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity