GEO Profile Links for Gene (Select 234374) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2921

<< First< Prev

Page of 147

Next >Last >>

Select item 279976871.

Ddx49 - Spinal cord and dorsal root ganglion

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1435681_s_at (ID_REF), GDS2209, 234374 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 27997687

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 414374172.

Homer3 - Nephronophthisis model

Annotation:: Homer3, Homer homolog 3 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL2897, 397065 (ID_REF), GDS2817, BU509937

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41437417

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 280199423.

Ddx49 - Spinal cord and dorsal root ganglion

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1457947_at (ID_REF), GDS2209, 234374 (Gene ID), BB727946

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28019942

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 505159464.

Ddx49 - pRb p107 double deficient skin

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL339, 1435681_s_at (ID_REF), GDS3176, 234374 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 50515946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 188098175.

Homer3 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Homer3, Homer homolog 3 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL2897, 397065 (ID_REF), GDS1729, BU509937

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18809817

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 172154876.

Ddx49 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1435681_s_at (ID_REF), GDS1647, 234374 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17215487

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 280175587.

Ddx49 - Spinal cord and dorsal root ganglion

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1455563_at (ID_REF), GDS2209, 234374 (Gene ID), BM210028

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28017558

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 384896588.

Ddx49 - Neuralized embryoid bodies response to Hedgehog agonist

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1455563_at (ID_REF), GDS2707, 234374 (Gene ID), BM210028

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 38489658

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 618670879.

Ddx49 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1435681_s_at (ID_REF), GDS3596, 234374 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61867087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752214410.

Homer3 - MPSS transcriptome analysis project

Annotation:: Homer3, Homer homolog 3 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTCGTTCCAGCTGAG (ID_REF), GDS868, AW048708

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7522144

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 765984411.

Homer3 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Homer3, Homer homolog 3 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTCGTTCCAGCTGAG (ID_REF), GDS878, AW048708

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7659844

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6159666612.

Ddx49 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1245733 (ID_REF), GDS3582, NM_001024922, DDX49 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61596666

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11221938713.

Ddx49 - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 7 cerebellum

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1435681_s_at (ID_REF), GDS5089, 234374 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 112219387

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8904314214.

Ddx49 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1457947_at (ID_REF), GDS4408, 234374 (Gene ID), BB727946

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89043142

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5977895815.

Ddx49 - Skeletal muscle response to myostatin inhibition

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1455563_at (ID_REF), GDS3526, 234374 (Gene ID), BM210028

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 59778958

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13120795816.

Ddx49 - FLT3/ITD-SmoM2 acute myeloid leukemia model: sorted bone marrow cells

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1455563_at (ID_REF), GDS5806, 234374 (Gene ID), BM210028

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131207958

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5595605817.

Ddx49 - Dicer deficiency effect on embryonic stem cells

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1455563_at (ID_REF), GDS3404, 234374 (Gene ID), BM210028

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 55956058

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5168505818.

Ddx49 - Cytotoxic T cell line response to interleukin-2: time course

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1455563_at (ID_REF), GDS3222, 234374 (Gene ID), BM210028

DataSet type:: Expression profiling by array, count, 43 samples

ID:: 51685058

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4683265719.

Homer3 - Dicer inactivation effect on the embryonic heart

Annotation:: Homer3, Homer homolog 3 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL5025, 35157 (ID_REF), GDS3033, BU509937

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46832657

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12446425820.

Ddx49 - Neuron-specific T-box transcription factor deficiency effect on embryonic day 16.5 forebrains

Annotation:: Ddx49, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Organism:: Mus musculus

Reporter:: GPL1261, 1455563_at (ID_REF), GDS5389, 234374 (Gene ID), BM210028

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124464258

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 147

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 234374) (2921)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2921

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity