GEO Profile Links for Gene (Select 52666) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 4128

<< First< Prev

Page of 207

Next >Last >>

Select item 1303728621.

Arhgef25 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL4134, 27862 (ID_REF), GDS5664, NM_028027, A_51_P451516 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130372862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 922877612.

Arhgef25 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1426855_at (ID_REF), GDS4432, 52666 (Gene ID)

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92287761

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756719483.

Arhgef25 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL6481, 5900037 (ID_REF), GDS4002, NM_028027, D10Ertd610e (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75671948

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 719142744.

Arhgef25 - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1259949 (ID_REF), GDS3900, NM_028027

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71914274

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 569484615.

Arhgef25 - Vancomycin effect on the kidney: dose response

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1426855_at (ID_REF), GDS3435, 52666 (Gene ID)

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56948461

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 370117616.

Arhgef25 - Asthma model: lungs

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1426855_at (ID_REF), GDS2647, 52666 (Gene ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37011761

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 217732977.

Arhgef25 - Strains exhibiting low or high freezing in response to fear: amygdala and hippocampus

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1419978_s_at (ID_REF), GDS1901, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 21773297

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270610628.

Arhgef25 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL4134, 27862 (ID_REF), GDS5461, NM_028027, A_51_P451516 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127061062

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 984311979.

Arhgef25 - Chronic suppression of phosphodiesterase 10A effect on striatum and hippocampus

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1419978_s_at (ID_REF), GDS4542, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, transformed count, 42 samples

ID:: 98431197

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7462041610.

Arhgef25 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1259949 (ID_REF), GDS3974, NM_028027, D10ERTD610E (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74620416

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5697128611.

Arhgef25 - Vancomycin effect on the kidney: dose response

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1449687_at (ID_REF), GDS3435, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56971286

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2215379712.

Arhgef25 - High and low level freezing in response to fear: amygdala and hippocampus

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1419978_s_at (ID_REF), GDS1921, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 22153797

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12772151613.

Arhgef25 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1259949 (ID_REF), GDS5520, NM_028027, D10ERTD610E (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127721516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12161169714.

Arhgef25 - Antidepressant fluoxetine effect on depression model: ventral dentate gyrus

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1419978_s_at (ID_REF), GDS5308, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121611697

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12156519715.

Arhgef25 - Antidepressant fluoxetine effect on depression model: dorsal dentate gyrus

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1419978_s_at (ID_REF), GDS5307, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121565197

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11097319716.

Arhgef25 - Histone demethylase KDM1A deficiency effect on 3T3-L1 preadipocytes: time course

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1419978_s_at (ID_REF), GDS5055, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 110973197

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3703458617.

Arhgef25 - Asthma model: lungs

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1261, 1449687_at (ID_REF), GDS2647, 52666 (Gene ID), AU014694

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37034586

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 763875618.

Arhgef25 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGTCAGTTCCACTCCC (ID_REF), GDS878, BC023367

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7638756

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12759397419.

Arhgef25 - Progranulin deficiency effect on various brain regions: time course

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1259949 (ID_REF), GDS5501, NM_028027

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127593974

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12482707420.

Arhgef25 - DPP4A overexpression effect on fibroblast cell line

Annotation:: Arhgef25, Rho guanine nucleotide exchange factor (GEF) 25

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1259949 (ID_REF), GDS5400, NM_028027

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124827074

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 207

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 52666) (4128)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 4128

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity