GEO Profile Links for Gene (Select 72727) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2668

<< First< Prev

Page of 134

Next >Last >>

Select item 728417211.

B3gat3 - Spatial and temporal development of mammalian salivary glands

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P201315 (ID_REF), GDS3922, AK079723, A_52_P201315 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72841721

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 211718492.

B3gat3 - Postnatal day 7 and adult cerebellum: glycoconjugate expression profile

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Homo sapiens, Mus musculus

Reporter:: GPL1420, BC004038_Copy2_at (ID_REF), GDS1854, BC004038

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21171849

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211718483.

B3gat3 - Postnatal day 7 and adult cerebellum: glycoconjugate expression profile

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Homo sapiens, Mus musculus

Reporter:: GPL1420, BC004038_Copy1_at (ID_REF), GDS1854, BC004038

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21171848

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211718394.

B3gat3 - Postnatal day 7 and adult cerebellum: glycoconjugate expression profile

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Homo sapiens, Mus musculus

Reporter:: GPL1420, 1416960_Copy1_at (ID_REF), GDS1854, NM_024256

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21171839

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 207317425.

B3gat3 - Testosterone effect on female lacrimal, meibomian, and submandibular glands

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1310, 8742 (ID_REF), GDS1832, NM_024256

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 20731742

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211718506.

B3gat3 - Postnatal day 7 and adult cerebellum: glycoconjugate expression profile

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Homo sapiens, Mus musculus

Reporter:: GPL1420, BC004038_Copy3_at (ID_REF), GDS1854, BC004038

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21171850

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211718407.

B3gat3 - Postnatal day 7 and adult cerebellum: glycoconjugate expression profile

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Homo sapiens, Mus musculus

Reporter:: GPL1420, 1416960_Copy2_at (ID_REF), GDS1854, NM_024256

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21171840

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130392428.

B3gat3 - Testosterone effect on meibomian gland

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1310, 8742 (ID_REF), GDS1361, NM_024256

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 13039242

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211718419.

B3gat3 - Postnatal day 7 and adult cerebellum: glycoconjugate expression profile

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Homo sapiens, Mus musculus

Reporter:: GPL1420, 1416960_Copy3_at (ID_REF), GDS1854, NM_024256

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21171841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7061062510.

B3gat3 - Embryonic development of male reproductive tract tissues

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1261, 1431219_at (ID_REF), GDS3862, 72727 (Gene ID), BB634613

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70610625

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746656811.

B3gat3 - MPSS transcriptome analysis project

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCTTCCTACCTCTAG (ID_REF), GDS868, NM_024256

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7466568

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4543399112.

B3gat3 - Vitamin E supplementation effect on aged brain

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1261, 1416960_at (ID_REF), GDS2973, 72727 (Gene ID), NM_024256

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45433991

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 903944213.

B3gat3 - Male and female salivary gland comparison

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1310, 8742 (ID_REF), GDS1009, NM_024256

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 9039442

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11940772114.

B3gat3 - Chronic, low level drug exposure effect on obese liver

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P201315 (ID_REF), GDS5258, AK079723, A_52_P201315 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119407721

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6190549115.

B3gat3 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1261, 1416960_at (ID_REF), GDS3598, 72727 (Gene ID), NM_024256

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61905491

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3317289116.

B3gat3 - Polyglutamine expansion disease model: retina

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL339, 1416960_at (ID_REF), GDS2464, 72727 (Gene ID), NM_024256

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 33172891

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1721102517.

B3gat3 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1261, 1431219_at (ID_REF), GDS1647, 72727 (Gene ID), BB634613

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17211025

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4736729118.

B3gat3 - Various normal tissues

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1261, 1416960_at (ID_REF), GDS3052, 72727 (Gene ID), NM_024256

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 47367291

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4137089119.

B3gat3 - Ras-GRF1 deficiency effect on the hippocampus

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL339, 1416960_at (ID_REF), GDS2816, 72727 (Gene ID), NM_024256

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41370891

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2645882520.

B3gat3 - PGC-1alpha null brown adipocyte response to cAMP

Annotation:: B3gat3, beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Organism:: Mus musculus

Reporter:: GPL1261, 1431219_at (ID_REF), GDS2149, 72727 (Gene ID), BB634613

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 26458825

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 134

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 72727) (2668)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2668

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity