GEO Profile Links for Gene (Select 75642) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 921

<< First< Prev

Page of 47

Next >Last >>

Select item 890177041.

Spata25 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1261, 1432498_at (ID_REF), GDS4408, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89017704

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 279945042.

Spata25 - Spinal cord and dorsal root ganglion

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1261, 1432498_at (ID_REF), GDS2209, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 27994504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1125150073.

Spata25 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL4783, M200011015 (ID_REF), GDS2645, AK006145

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112515007

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 233987444.

Spata25 - Lymphotoxin-beta receptor signaling inhibition effect on lymph nodes: time course (MG-430B)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL340, 1432498_at (ID_REF), GDS2005, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 23398744

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129893505.

Spata25 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL891, 5450 (ID_REF), GDS1359, AK006145, A_51_P484599 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12989350

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 59547506.

Spata25 - High fat diet effect on aorta: time course

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL891, 5450 (ID_REF), GDS735, AK006145, A_51_P484599 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5954750

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162539567.

Spata25 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2619416 (ID_REF), GDS5172, XM_130672, 1700020C07RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116253956

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1031726048.

Spata25 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL11180, 1432498_PM_at (ID_REF), GDS4791, AK006145

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103172604

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74675529.

Spata25 - MPSS transcriptome analysis project

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGGAGGGGTTCCTGC (ID_REF), GDS868, AK006145

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7467552

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3758554410.

Spata25 - Embryonic V6.5 stem cell differentiation in vitro (MG-430B)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL340, 1432498_at (ID_REF), GDS2672, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37585544

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3259390411.

Spata25 - Limbal and central corneal epithelial basal cell comparison

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1261, 1432498_at (ID_REF), GDS2433, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 32593904

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3753884412.

Spata25 - Embryonic J1 stem cell differentiation in vitro (MG-430B)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL340, 1432498_at (ID_REF), GDS2669, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37538844

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9401000413.

Spata25 - Gonadal development: ovaries and testes

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1261, 1432498_at (ID_REF), GDS4503, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94010004

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3144550414.

Spata25 - Male germ cells

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1261, 1432498_at (ID_REF), GDS2390, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31445504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3749214415.

Spata25 - Embryonic R1 stem cell differentiation in vitro (MG-430B)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL340, 1432498_at (ID_REF), GDS2667, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37492144

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 2463464416.

Spata25 - Transcription factor Egr3 expression effect on primary myotubes (MG-430B)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL340, 1432498_at (ID_REF), GDS2060, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 24634644

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2017990417.

Spata25 - Age effect on hematopoietic stem cells

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1261, 1432498_at (ID_REF), GDS1803, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20179904

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2652954418.

Spata25 - RNA helicase p68/p72 knockdown effect on skeletal muscle cells (MG-430B)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL340, 1432498_at (ID_REF), GDS2152, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 26529544

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 669354419.

Spata25 - Preimplantation embryo development (MOE430B)

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL340, 1432498_at (ID_REF), GDS814, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 6693544

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7218250420.

Spata25 - Polyubiquitin knockout effect on testis: time course

Annotation:: Spata25, spermatogenesis associated 25

Organism:: Mus musculus

Reporter:: GPL1261, 1432498_at (ID_REF), GDS3906, 75642 (Gene ID), AK006145

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72182504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 47

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 75642) (921)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 921

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity