GEO Profiles Links for Nucleotide (Select 26082546) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 18

Select item 529759941.

6330415G19Rik - Liver response to Pacific ciguatoxin-1: time course

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL2872, 29594 (ID_REF), GDS3259, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52975994

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 518176942.

6330415G19Rik - Interleukin-22 effect on colon cultures

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL2872, 29594 (ID_REF), GDS3226, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51817694

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1092425633.

6330415G19Rik - Diabetic db/db heart response to rosiglitazone

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL4134, 32663 (ID_REF), GDS4990, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109242563

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 643257864.

6330415G19Rik - Hypertension model: aorta

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100092183_TGI_at (ID_REF), GDS3672, AK031835

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64325786

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1153303635.

6330415G19Rik - Glucocorticoid effect on the female liver

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL4134, 32663 (ID_REF), GDS5036, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115330363

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1152837636.

6330415G19Rik - Glucocorticoid effect on the male liver

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL4134, 32663 (ID_REF), GDS5035, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115283763

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644445867.

6330415G19Rik - Hypertension model: kidney

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100092183_TGI_at (ID_REF), GDS3675, AK031835

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64444586

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 319039948.

6330415G19Rik - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL2872, 29594 (ID_REF), GDS2413, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31903994

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1270658639.

6330415G19Rik - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL4134, 32663 (ID_REF), GDS5461, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127065863

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 13037766310.

6330415G19Rik - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL4134, 32663 (ID_REF), GDS5664, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130377663

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9783798611.

6330415G19Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100092183_TGI_at (ID_REF), GDS4527, AK031835

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97837986

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9712498612.

6330415G19Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100092183_TGI_at (ID_REF), GDS4495, AK031835

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97124986

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 5520496313.

6330415G19Rik - Iron enriched and deficient diets effect on the liver

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL4134, 32663 (ID_REF), GDS3373, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55204963

GEO DataSets Gene Chromosome neighbors

Select item 6440498614.

6330415G19Rik - Hypertension model: liver

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100092183_TGI_at (ID_REF), GDS3674, AK031835

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64404986

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12230996315.

6330415G19Rik - Industrial pollution effect on liver

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 32663 (ID_REF), GDS5331, AK031835, A_52_P582619 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122309963

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6436538616.

6330415G19Rik - Hypertension model: heart

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100092183_TGI_at (ID_REF), GDS3673, AK031835

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64365386

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 762636817.

6330415G19Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGACACCCTGGAGCTA (ID_REF), GDS878, AK031835

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7626368

GEO DataSets Gene Chromosome neighbors

Select item 748866818.

6330415G19Rik - MPSS transcriptome analysis project

Annotation:: 6330415G19Rik, RIKEN cDNA 6330415G19 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGACACCCTGGAGCTA (ID_REF), GDS868, AK031835

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7488668

GEO DataSets Gene Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26082546) (18)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 18

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity