GEO Profiles Links for Nucleotide (Select 26102192) - GEO Profiles - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 8

Select item 76539721.

Value/Rank Plot

MPSS analysis of BLK CL.4 and liver cells

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGGCCTGGCGCACT (ID_REF), GDS878, AK084739

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7653972

Select item 644649842.

Value/Rank Plot

Hypertension model: kidney

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100081371_TGI_at (ID_REF), GDS3675, AK084739

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64464984

GEO DataSets Profile neighbors

Select item 643857843.

Value/Rank Plot

Hypertension model: heart

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100081371_TGI_at (ID_REF), GDS3673, AK084739

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64385784

GEO DataSets Profile neighbors

Select item 644253844.

Value/Rank Plot

Hypertension model: liver

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100081371_TGI_at (ID_REF), GDS3674, AK084739

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64425384

GEO DataSets Profile neighbors

Select item 643461845.

Value/Rank Plot

Hypertension model: aorta

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100081371_TGI_at (ID_REF), GDS3672, AK084739

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64346184

GEO DataSets Profile neighbors

Select item 978583846.

Value/Rank Plot

Atherosclerosis susceptibility model: macrophages

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100081371_TGI_at (ID_REF), GDS4527, AK084739

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97858384

GEO DataSets Profile neighbors

Select item 971453847.

Value/Rank Plot

SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL9734, 100081371_TGI_at (ID_REF), GDS4495, AK084739

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97145384

GEO DataSets Profile neighbors

Select item 75162728.

Value/Rank Plot

MPSS transcriptome analysis project

Annotation:: Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330037E20 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGGCCTGGCGCACT (ID_REF), GDS868, AK084739

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7516272

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26102192) (8)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles