GEO Profiles Links for Nucleotide (Select 28972116) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 16

Select item 971437881.

Phf3 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL9734, 100099716_TGI_at (ID_REF), GDS4495, AK122230

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97143788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644237882.

Phf3 - Hypertension model: liver

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL9734, 100099716_TGI_at (ID_REF), GDS3674, AK122230

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64423788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 978567883.

Phf3 - Atherosclerosis susceptibility model: macrophages

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL9734, 100099716_TGI_at (ID_REF), GDS4527, AK122230

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97856788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44535444.

Phf3 - Preimplantation development

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL870, 7744 (ID_REF), GDS578, AK010013, AK017402, AK045780, AK122230, BC011226, BC019710, BC032205, BC038053, H3053C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4453544

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644633885.

Phf3 - Hypertension model: kidney

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL9734, 100099716_TGI_at (ID_REF), GDS3675, AK122230

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64463388

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643445886.

Phf3 - Hypertension model: aorta

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL9734, 100099716_TGI_at (ID_REF), GDS3672, AK122230

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64344588

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643841887.

Phf3 - Hypertension model: heart

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL9734, 100099716_TGI_at (ID_REF), GDS3673, AK122230

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64384188

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 327379458.

Phf3 - Prostate cancer progression model: stromal cell

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL4371, 14545 (ID_REF), GDS2443, AK122230

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32737945

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74703319.

Phf3 - MPSS transcriptome analysis project

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTGTGTTTTGCTATCC (ID_REF), GDS868, AK122230

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7470331

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3273786110.

Phf3 - Prostate cancer progression model: stromal cell

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL4371, 14461 (ID_REF), GDS2443, AK122230

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32737861

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1089429611.

Phf3 - Neuroblastoma differentiation induced by retinoic acid: time course

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL1964, 496 (ID_REF), GDS1243, AK122230

DataSet type:: Expression profiling by array, transformed count, 38 samples

ID:: 10894296

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3273357412.

Phf3 - Prostate cancer progression model: stromal cell

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL4371, 10174 (ID_REF), GDS2443, AK122230

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32733574

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447684413.

Phf3 - Zygotic gene activation

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL870, 7744 (ID_REF), GDS579, AK010013, AK017402, AK045780, AK122230, BC011226, BC019710, BC032205, BC038053, H3053C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4476844

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 760803114.

Phf3 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTGTGTTTTGCTATCC (ID_REF), GDS878, AK122230

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7608031

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 614404415.

Phf3 - Blastocyst dormancy and activation comparison

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL870, 7744 (ID_REF), GDS752, AK010013, AK017402, AK045780, AK122230, BC011226, BC019710, BC032205, BC038053, H3053C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6144044

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3273018616.

Phf3 - Prostate cancer progression model: stromal cell

Annotation:: Phf3, PHD finger protein 3

Organism:: Mus musculus

Reporter:: GPL4371, 6786 (ID_REF), GDS2443, AK122230

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32730186

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 28972116) (16)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 16

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity