GEO Profiles Links for Nucleotide (Select 71143128) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 350

<< First< Prev

Page of 18

Next >Last >>

Select item 1275910761.

Rgs8 - Progranulin deficiency effect on various brain regions: time course

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2732430 (ID_REF), GDS5501, NM_026380

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127591076

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 921840942.

Rgs8 - 16p11.2 copy number variation models: various brain regions

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6246, 10350725 (ID_REF), GDS4430, NM_026380, XM_006529819, XM_006529821, BC065056, BC094577, chr1:153653037-153697665 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 37 samples

ID:: 92184094

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 615933623.

Rgs8 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2732430 (ID_REF), GDS3582, NM_026380, RGS8 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61593362

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625601304.

Rgs8 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6333, scl067792.1_262-S (ID_REF), GDS3621, NM_026380, 6530413N01Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62560130

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74770145.

Rgs8 - MPSS transcriptome analysis project

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTATAGACCTAAGCAA (ID_REF), GDS868, NM_026380

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7477014

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1304651136.

Rgs8 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P635598 (ID_REF), GDS5666, NM_026380, A_52_P635598 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130465113

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159110627.

Rgs8 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2732430 (ID_REF), GDS5157, NM_026380, RGS8 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115911062

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 661939808.

Rgs8 - X chromosome dosage model

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2732430 (ID_REF), GDS3728, NM_026380

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66193980

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1212924769.

Rgs8 - Restless Legs Syndrome model: adult whole brain

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2732430 (ID_REF), GDS5299, NM_026380

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121292476

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10925709410.

Rgs8 - Glyoxalase 1 overexpression effect on the brain

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6246, 10350725 (ID_REF), GDS4991, NM_026380, XM_006529819, XM_006529821, BC065056, BC094577, chr1:153653037-153697665 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 109257094

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7191137611.

Rgs8 - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2732430 (ID_REF), GDS3900, NM_026380

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71911376

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6256013112.

Rgs8 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6333, scl17360.1.193_85-S (ID_REF), GDS3621, NM_026380, 6530413N01Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62560131

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12908389413.

Rgs8 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6246, 10350725 (ID_REF), GDS5628, NM_026380, XM_006529819, XM_006529821, BC065056, BC094577, chr1:153653037-153697665 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129083894

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11884686514.

Rgs8 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: cerebellum

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P600417 (ID_REF), GDS5241, NM_026380, A_52_P600417 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118846865

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7566117915.

Rgs8 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6481, 6760440 (ID_REF), GDS4002, NM_026380, 6530413N01Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75661179

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 5297333716.

Rgs8 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL2872, 26937 (ID_REF), GDS3259, NM_026380, A_52_P600417 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52973337

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4904593517.

Rgs8 - Chronic hypoxia effect on the developing brain

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL5402, scl067792.1_262 (ID_REF), GDS3114, NM_026380

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 49045935

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9741819418.

Rgs8 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL6246, 10350725 (ID_REF), GDS4517, NM_026380, XM_006529819, XM_006529821, BC065056, BC094577, chr1:153653037-153697665 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97418194

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13046406519.

Rgs8 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P600417 (ID_REF), GDS5666, NM_026380, A_52_P600417 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130464065

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5181503720.

Rgs8 - Interleukin-22 effect on colon cultures

Annotation:: Rgs8, regulator of G-protein signaling 8

Organism:: Mus musculus

Reporter:: GPL2872, 26937 (ID_REF), GDS3226, NM_026380, A_52_P600417 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51815037

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 18

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 71143128) (350)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 350

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity