Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Inhibition of LPS-induced STAT1 phosphorylation in mouse RAW264.7 cells pretreated with compound for 2 hrs followed by LPS-stimulation and measured after 30 mins by immunoblot analysis
Assay data:2 Tested
SummaryPubMed CitationRelated BioAssays by Target
Inhibition of STAT1 phosphorylation in mouse BAF3 cells at 1000 nM after 2 hrs by Western blot analysis
Assay data:1 Tested
Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract at 10 uM preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
Assay data:10 Active, 10 Tested
SummaryCompounds, ActivePubMed CitationRelated BioAssays by Target
Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
Assay data:5 Tested
Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
Assay data:5 Active, 5 Tested
Inhibition of LPS-induced STAT1 phosphorylation at S727 in C57BL/6 mouse peritoneal macrophages at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 30 mins by Western blot analysis
Assay data:1 Active, 1 Tested
Inhibition of LPS-induced STAT1 phosphorylation at Y701 in C57BL/6 mouse peritoneal macrophages at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 120 mins by Western blot analysis
Inhibition of LPS-induced STAT1 phosphorylation at S727 in mouse RAW264.7 cells at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 15 mins by Western blot analysis
Inhibition of LPS-induced STAT1 phosphorylation at Y701 in mouse RAW264.7 cells at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 120 mins by Western blot analysis
Inhibition of LPS-induced STAT1 phosphorylation at Y701 residue in mouse RAW264.7 cells at 40 uM preincubated for 30 mins followed by LPS-stimulation and measured up to 240 mins by Western blot analysis
Inhibition of LPS-induced STAT1 phosphorylation at Y701 residue in mouse RAW264.7 cells at 5 uM preincubated for 30 mins followed by LPS-stimulation and measured up to 240 mins by Western blot analysis
Inhibition of IL6-induced STAT1 phosphorylation at Y701 in CD4+ T lymphocytes isolated from C57BL/6J mouse preincubated for 2 hrs followed by activation with plate-bound anti-CD3/anti-CD28 and IL6 for 15 mins by Western blot analysis
Assay data:6 Tested
Modulation of EGF-induced Stat1 phosphorylation in mouse NIH3T3 cells expressing human EGFR at 5 uM preincubated for 3 hrs followed by stimulation with 1 ug/ml EGF for 12 mins by immunoblot analysis
Assay data:4 Tested
Inhibition of Stat1:Stat3 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA
Inhibition of Stat1 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA
Assay data:1 Active, 12 Tested
Inhibition of Stat1 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR assessed as residual activity at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA
Inhibition of Stat1:Stat3 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR assessed as residual activity at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA
Genome-wide siRNA screen of genes regulating the Lipopolysaccharide-induced NF-kappaB and TNF-alpha responses in mouse macrophages_Primary screen NFkB readout
Assay data:762 Active, 16821 Tested
SummaryRelated BioAssays by Same Project
Genome-wide siRNA screen of genes regulating the Lipopolysaccharide-induced NF-kappaB and TNF-alpha responses in mouse macrophages_Primary screen TNF readout
Assay data:1106 Active, 16821 Tested
TLR-pathway-mouse_LPS ligand_TNF readout
Assay data:130 Active, 756 Tested
SummaryPubMed CitationRelated BioAssays by DepositorRelated BioAssays by Same Project
Filters: Manage Filters
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on