Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Antiviral activity against HIV-1 harboring integrase Q148K mutant
Assay data:4 Active, 3 Activity ≤ 1 nM, 4 Activity ≤ 1 µM, 4 Tested
SummaryCompounds, ActiveCompounds, activity ≤ 1 µMPubMed Citation
Antiviral activity against HIV-1 harboring integrase Y143R mutant
Assay data:4 Active, 2 Activity ≤ 1 nM, 4 Activity ≤ 1 µM, 4 Tested
Antiviral activity against HIV-1 harboring integrase N155H mutant
Assay data:6 Active, 1 Activity ≤ 1 nM, 6 Activity ≤ 1 µM, 6 Tested
Antiviral activity against HIV-1 harboring integrase Q148R mutant
Assay data:6 Active, 2 Activity ≤ 1 nM, 6 Activity ≤ 1 µM, 6 Tested
Antiviral activity against HIV-1 assessed as inhibition of HIV infection in human T cells
Assay data:1 Active, 1 Activity ≤ 1 µM, 1 Tested
Quantitative High-Throughput drug screen in 47 multiple myeloma cell lines against the NCATS MIPE library collection: MMM1_PLB cell viability assay
Assay data:911 Active, 7 Activity ≤ 1 nM, 657 Activity ≤ 1 µM, 1912 Tested
SummaryCompounds, ActiveCompounds, activity ≤ 1 µMPubMed CitationRelated BioAssays by Depositor
Quantitative High-Throughput drug screen in 47 multiple myeloma cell lines against the NCATS MIPE library collection: AMO1_DSMZ cell viability assay
Assay data:746 Active, 20 Activity ≤ 1 nM, 455 Activity ≤ 1 µM, 1912 Tested
Inhibition of recombinant HIV-1 integrase strand transfer activity by enzymatic assay
SummaryCompounds, ActiveCompounds, activity ≤ 1 µMPubMed CitationRelated BioAssays by Target
Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as DNA substrate incubated for 2 hrs by densitometric analysis
Assay data:6 Active, 3 Activity ≤ 1 µM, 14 Tested
Microtiter Plate Assay for Strand Transfer from Article 10.1021/jm800245z: "Discovery of raltegravir, a potent, selective orally bioavailable HIV-integrase inhibitor for the treatment of HIV-AIDS infection."
Assay data:24 Active, 24 Activity ≤ 1 µM, 25 Tested
Antiviral activity against HIV1 LAV infected in human MT4 cells assessed as reduction in viral replication by measuring reduction in p24 expression incubated for 72 hrs by ELISA
Assay data:2 Active, 1 Activity ≤ 1 µM, 3 Tested
Inhibition of HIV1 integrase assessed as reduction in LEDGF-independent integration pre-incubated for 1 hr before addition of DNA donor and acceptor substrate and measured after 90 mins by HTRF assay
Inhibition of wild type recombinant HIV1 His6-tagged integrase expressed in Escherichia coli BL21 using 18 nucleotide 3'-biotin labeled DNA acceptor as substrate preincubated for 1 hr followed by substrate addition and further incubated for 90 mins in presence of recombinant LEDGF/p75 by HTRF assay
Antiviral activity against HIV1 infected in human P4R5 cells assessed as reduction of virus replication preincubated with cells for 24 hrs followed by viral infection for 48 hrs by 4-methylumbelliferylgalactoside-based MAGI assay
Assay data:10 Active, 8 Activity ≤ 1 µM, 10 Tested
Antiviral activity against HIV1 3B infected in human CEM-SS cells assessed as reduction of virus-induced cytopathic effect after 6 days by MTS assay
Assay data:9 Active, 9 Activity ≤ 1 µM, 9 Tested
Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand transfer activity assay
Assay data:26 Active, 25 Activity ≤ 1 µM, 34 Tested
Antiviral activity against HIV1 NL4.3 infected in human TZM-bl cells measured upto 24 hrs by bright Glo-luciferase reporter gene assay
Assay data:3 Active, 2 Activity ≤ 1 µM, 4 Tested
Antiviral activity against HIV1 NL4-3 harboring G140S/Q148H mutant infected in human MT2 cells measured after 3 to 4 days by luciferase reporter gene assay
Assay data:4 Active, 3 Activity ≤ 1 µM, 4 Tested
Antiviral activity against HIV1 NL4-3 infected in human MT2 cells measured after 3 to 4 days by luciferase reporter gene assay
Assay data:23 Active, 20 Activity ≤ 1 µM, 34 Tested
Antiviral activity against HIV-1 infected in human P4R5 cells assessed as reduction in viral replication preincubated for 24 hrs followed by viral infection and measured after 48 hrs by MAGI assay
Assay data:7 Active, 2 Activity ≤ 1 µM, 23 Tested
Filters: Manage Filters
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on