ITS soil metagenome olive - SRA

Links from BioSample

SRX25207308: ITS soil metagenome olive
1 ILLUMINA (Illumina NovaSeq 6000) run: 182,683 spots, 81.1M bases, 28Mb downloads

Design: For ITS, the ITS1-1F region was amplified using the PCR primers ITS1-1F-F (CTTGGTCATTTAGAGGAAGTAA) and ITS1-1F-R (GCTGCGTTCTTCATCGATGC) resulting in a product of 200-400 bp

Submitted by: University of Malaga

Study: Effect of cover crops on the soil microbial biodiversity of an olive trees field in Spain

PRJNA1131742 • SRP517935 • All experiments • All runs

show Abstracthide Abstract

The international LivinGro initiative was implemented in an olive orchard in Valladolid, Spain. A comprehensive study was conducted to evaluate the impact of implementing multifunctional cover crops on microbial biodiversity and soil health in the inter-row area. The current work spanned a five-month period, with data collected at two sampling intervals (September 2021 and January 2022).

Sample:

SAMN42317843 • SRS21894989 • All experiments • All runs

Organism: soil metagenome

Library:

Name: ITS.POZ.T.A8

Instrument: Illumina NovaSeq 6000

Strategy: AMPLICON

Source: GENOMIC

Selection: PCR

Layout: PAIRED

Runs: 1 run, 182,683 spots, 81.1M bases, 28Mb

Run	# of Spots	# of Bases	Size	Published
SRR29704712	182,683	81.1M	28Mb	2024-07-04

ID:: 33548048

SRA

Sequence Read Archive

Result Filters

Send to:

Links from BioSample

Supplemental Content

Related information

Recent activity