txid11041[Organism] - GEO DataSets

Warning: The NCBI web site requires JavaScript to function. more...

Format

Summary
Summary (text)
Unique Identifier List

Sort by

Default order
Number of Samples (High to Low)
Number of Samples (Low to High)

Send to:

Choose Destination

File
Clipboard
Collections

Search results

Items: 2

Select item 2001041481.

Characterization of rubella-specific humoral immunity following two doses of MMR vaccine using proteome microarray technology

(Submitter supplied) This study uses proteome microarray technology/data to identify predictive biomarkers of neutralizing antibody response and potential new correlates of protective immunity in rubella virus serology.

Organism:: Homo sapiens; Rubella virus vaccine strain RA27/3

Type:: Protein profiling by protein array

Platform:: GPL24038
150 Samples

Download data: CSV

Series

Accession:: GSE104148

ID:: 200104148

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 1000240382.

Rubella virus-specific proteome microarray chip (Antigen Discovery, Inc., Irvine, CA)

(Submitter supplied) cDNAs were created by RT-PCR from Rubella virus/RV (strain RA27/3, Taxonomy ID) infected cells (total RNAs were extracted using the Qiagen RNeasy Plus mini kit and PCR was performed using the Novagen’s KOD Hot Start DN Polymerase kit/Cat # 71086). The following RV-specific primers were used: for envelope glycoprotein 1/E1 RubE1-F gaggaggctttcacctacctctgca and RubE1-R gcgcggcgctatagcgc; for envelope glycoprotein 2/E2 RubE2-F gggctccagccccgcgct and RubE2-R gccataggcgggggggttgt ; for capsid protein/CP RubC-F atggcttctactacccccatcaccatgga and RubC-R ggcgcgcgcggtgcc ; for nonstructural protein P150 Rub150-F atggagagactcctagatgaggttc and Rub150-R gacagggggaccgcg ; for nonstructural protein P90 RubP90-F cggggcggtggcacc and RubP90-R tagtcagcgtcgtggagattggc. more...