cDNAs were created by RT-PCR from Rubella virus/RV (strain RA27/3, Taxonomy ID) infected cells (total RNAs were extracted using the Qiagen RNeasy Plus mini kit and PCR was performed using the Novagen’s KOD Hot Start DN Polymerase kit/Cat # 71086). The following RV-specific primers were used: for envelope glycoprotein 1/E1 RubE1-F gaggaggctttcacctacctctgca and RubE1-R gcgcggcgctatagcgc; for envelope glycoprotein 2/E2 RubE2-F gggctccagccccgcgct and RubE2-R gccataggcgggggggttgt ; for capsid protein/CP RubC-F atggcttctactacccccatcaccatgga and RubC-R ggcgcgcgcggtgcc ; for nonstructural protein P150 Rub150-F atggagagactcctagatgaggttc and Rub150-R gacagggggaccgcg ; for nonstructural protein P90 RubP90-F cggggcggtggcacc and RubP90-R tagtcagcgtcgtggagattggc. PCR amplicons were verified by sequencing. The amplicons were inserted into pXi T7-based exvectors, and the products were expressed in coupled in-vitro transcription-translation (IVTT) reactions as described previously (Doolan DL et al., Proteomics. 2008 Nov;8(22):4680-94) and printed onto microarray slides as protein/polypeptide spots representing the individual rubella virus proteins/polypeptides. Larger genes (P150 and P90) were amplified in segments overlapping by 150 nucleotides and expressed on the chip as three spots of overlapping polypeptides/fragments for P150 (i.e., P150s1, P150s2, and P150s3), and three spots for P90 (i.e., P90s1, P90s2, and the whole P90). Glycoproteins E1 and E2, and the capsid C protein were expressed on the chip as single spots.
Less...
More...