GEO help: Mouse over screen elements for information.
Status
Public on May 17, 2011
Title
Agilent-028004 SurePrint G3 Human GE 8x60K Microarray (Feature Number version)
Technology type
in situ oligonucleotide
Distribution
custom-commercial
Organism
Homo sapiens Manufacturer
Agilent Technologies
Manufacture protocol
Agilent 60-mer SurePrint technology. See manufacturer's web site at http://www.agilent.com/
Description
SurePrint G3 Human GE 8x60K Microarray
Submission date
May 17, 2011
Last update date
Nov 27, 2018
Organization
Agilent Technologies
E-mail(s)
cag_sales-na@agilent.com Phone
877-424-4536
URL
http://www.agilent.com Department
Street address
City
Palo Alto
State/province
CA
ZIP/Postal code
94304
Country
USA
Samples (3749)
GSM642879 , GSM642880 , GSM642881 , GSM642882 , GSM642883 , GSM642884
GSM642885 ,
GSM642886 ,
GSM642887 ,
GSM642888 ,
GSM725724 ,
GSM725725 ,
GSM725726 ,
GSM725727 ,
GSM725728 ,
GSM725729 ,
GSM725730 ,
GSM725731 ,
GSM725732 ,
GSM725733 ,
GSM743716 ,
GSM743717 ,
GSM743718 ,
GSM743719 ,
GSM743720 ,
GSM743721 ,
GSM743722 ,
GSM743723 ,
GSM743724 ,
GSM743725 ,
GSM743726 ,
GSM743727 ,
GSM743728 ,
GSM743729 ,
GSM743730 ,
GSM743731 ,
GSM743732 ,
GSM743733 ,
GSM743734 ,
GSM743735 ,
GSM743736 ,
GSM743737 ,
GSM743738 ,
GSM743739 ,
GSM794232 ,
GSM794233 ,
GSM794234 ,
GSM794235 ,
GSM794236 ,
GSM794237 ,
GSM795165 ,
GSM795166 ,
GSM801610 ,
GSM801611 ,
GSM801612 ,
GSM801613 ,
GSM801614 ,
GSM801615 ,
GSM855753 ,
GSM855754 ,
GSM855755 ,
GSM855756 ,
GSM855757 ,
GSM855758 ,
GSM855759 ,
GSM855760 ,
GSM855761 ,
GSM855762 ,
GSM855763 ,
GSM855764 ,
GSM855765 ,
GSM855766 ,
GSM871709 ,
GSM873258 ,
GSM873259 ,
GSM873260 ,
GSM873261 ,
GSM906988 ,
GSM906989 ,
GSM906990 ,
GSM906991 ,
GSM906992 ,
GSM906993 ,
GSM906994 ,
GSM906995 ,
GSM906996 ,
GSM906997 ,
GSM906998 ,
GSM906999 ,
GSM907000 ,
GSM907001 ,
GSM907002 ,
GSM907003 ,
GSM907004 ,
GSM907005 ,
GSM907006 ,
GSM907007 ,
GSM907008 ,
GSM907009 ,
GSM907010 ,
GSM907011 ,
GSM907012 ,
GSM911072 ,
GSM911073 ,
GSM911074 ,
GSM911075 ,
GSM911076 ,
GSM911077 ,
GSM911078 ,
GSM911079 ,
GSM911080 ,
GSM911081 ,
GSM911082 ,
GSM911083 ,
GSM911084 ,
GSM911085 ,
GSM911086 ,
GSM916679 ,
GSM916680 ,
GSM916681 ,
GSM916682 ,
GSM916683 ,
GSM916684 ,
GSM916685 ,
GSM916686 ,
GSM925635 ,
GSM925636 ,
GSM925637 ,
GSM925638 ,
GSM925639 ,
GSM925640 ,
GSM936718 ,
GSM936719 ,
GSM936720 ,
GSM936721 ,
GSM936722 ,
GSM936723 ,
GSM936724 ,
GSM936725 ,
GSM936726 ,
GSM936727 ,
GSM936728 ,
GSM936729 ,
GSM936730 ,
GSM936731 ,
GSM936732 ,
GSM936733 ,
GSM936734 ,
GSM936735 ,
GSM936736 ,
GSM936737 ,
GSM936738 ,
GSM936739 ,
GSM936740 ,
GSM936741 ,
GSM936742 ,
GSM936743 ,
GSM936744 ,
GSM936745 ,
GSM936746 ,
GSM936747 ,
GSM936748 ,
GSM936749 ,
GSM936750 ,
GSM936751 ,
GSM936752 ,
GSM936753 ,
GSM937756 ,
GSM937757 ,
GSM937758 ,
GSM937759 ,
GSM937760 ,
GSM937761 ,
GSM937762 ,
GSM937763 ,
GSM937764 ,
GSM937765 ,
GSM937766 ,
GSM937767 ,
GSM937768 ,
GSM937769 ,
GSM937770 ,
GSM937771 ,
GSM937772 ,
GSM937773 ,
GSM937774 ,
GSM937775 ,
GSM937776 ,
GSM937777 ,
GSM937778 ,
GSM937779 ,
GSM937780 ,
GSM937781 ,
GSM937782 ,
GSM937783 ,
GSM937784 ,
GSM937785 ,
GSM937786 ,
GSM937787 ,
GSM937788 ,
GSM937789 ,
GSM937790 ,
GSM937791 ,
GSM937792 ,
GSM937793 ,
GSM937794 ,
GSM937795 ,
GSM937796 ,
GSM937797 ,
GSM937798 ,
GSM937799 ,
GSM937800 ,
GSM937801 ,
GSM937802 ,
GSM937803 ,
GSM937804 ,
GSM937805 ,
GSM937806 ,
GSM937807 ,
GSM937808 ,
GSM937809 ,
GSM937810 ,
GSM937811 ,
GSM937812 ,
GSM937813 ,
GSM937814 ,
GSM937815 ,
GSM937816 ,
GSM937817 ,
GSM937818 ,
GSM937819 ,
GSM938373 ,
GSM938374 ,
GSM938375 ,
GSM938376 ,
GSM938377 ,
GSM938378 ,
GSM938379 ,
GSM938380 ,
GSM946311 ,
GSM946312 ,
GSM946313 ,
GSM946314 ,
GSM946315 ,
GSM946316 ,
GSM946317 ,
GSM946318 ,
GSM946319 ,
GSM946320 ,
GSM946321 ,
GSM946322 ,
GSM946323 ,
GSM946324 ,
GSM946325 ,
GSM949289 ,
GSM949290 ,
GSM949291 ,
GSM949292 ,
GSM949293 ,
GSM949294 ,
GSM949295 ,
GSM949296 ,
GSM954279 ,
GSM954280 ,
GSM954281 ,
GSM954282 ,
GSM954283 ,
GSM954284 ,
GSM954285 ,
GSM954286 ,
GSM954287 ,
GSM954288 ,
GSM954289 ,
GSM954290 ,
GSM954291 ,
GSM954292 ,
GSM954293 ,
GSM954294 ,
GSM957658 ,
GSM957659 ,
GSM957660 ,
GSM957661 ,
GSM978826 ,
GSM978827 ,
GSM978828 ,
GSM978829 ,
GSM978830 ,
GSM978831 ,
GSM978832 ,
GSM978833 ,
GSM978834 ,
GSM978835 ,
GSM978897 ,
GSM978898 ,
GSM978899 ,
GSM978900 ,
GSM978901 ,
GSM978902 ,
GSM978903 ,
GSM978904 ,
GSM978905 ,
GSM978906 ,
GSM978907 ,
GSM978908 ,
GSM980947 ,
GSM980948 ,
GSM980949 ,
GSM980950 ,
GSM980951 ,
GSM980952 ,
GSM980953 ,
GSM980954 ,
GSM980955 ,
GSM980956 ,
GSM980957 ,
GSM980958 ,
GSM980959 ,
GSM980960 ,
GSM980961 ,
GSM980962 ,
GSM980963 ,
GSM980964 ,
GSM980965 ,
GSM980966 ,
GSM980967 ,
GSM980968 ,
GSM980969 ,
GSM980970 ,
GSM980971 ,
GSM980972 ,
GSM980973 ,
GSM980974 ,
GSM980975 ,
GSM980976 ,
GSM980977 ,
GSM980978 ,
GSM984946 ,
GSM984947 ,
GSM984948 ,
GSM984949 ,
GSM984950 ,
GSM984951 ,
GSM984952 ,
GSM984953 ,
GSM984954 ,
GSM984955 ,
GSM984956 ,
GSM984957 ,
GSM984958 ,
GSM984959 ,
GSM984960 ,
GSM984961 ,
GSM984962 ,
GSM984963 ,
GSM988218 ,
GSM988219 ,
GSM988220 ,
GSM988221 ,
GSM988222 ,
GSM988223 ,
GSM988224 ,
GSM988225 ,
GSM988226 ,
GSM988227 ,
GSM988228 ,
GSM988229 ,
GSM988230 ,
GSM988231 ,
GSM988232 ,
GSM988233 ,
GSM999592 ,
GSM999593 ,
GSM999594 ,
GSM999595 ,
GSM999596 ,
GSM999597 ,
GSM999598 ,
GSM999599 ,
GSM999600 ,
GSM999601 ,
GSM999602 ,
GSM999603 ,
GSM1023651 ,
GSM1023652 ,
GSM1028104 ,
GSM1028105 ,
GSM1028106 ,
GSM1028107 ,
GSM1033576 ,
GSM1033577 ,
GSM1033578 ,
GSM1033579 ,
GSM1033580 ,
GSM1033581 ,
GSM1033582 ,
GSM1033583 ,
GSM1033584 ,
GSM1033585 ,
GSM1033586 ,
GSM1033587 ,
GSM1033588 ,
GSM1033589 ,
GSM1033590 ,
GSM1033591 ,
GSM1033592 ,
GSM1033593 ,
GSM1033594 ,
GSM1033595 ,
GSM1033596 ,
GSM1033597 ,
GSM1033598 ,
GSM1033599 ,
GSM1040914 ,
GSM1040915 ,
GSM1040916 ,
GSM1040917 ,
GSM1054170 ,
GSM1054171 ,
GSM1054172 ,
GSM1054173 ,
GSM1054174 ,
GSM1054175 ,
GSM1054176 ,
GSM1054177 ,
GSM1054178 ,
GSM1054179 ,
GSM1054180 ,
GSM1054181 ,
GSM1054200 ,
GSM1054201 ,
GSM1054202 ,
GSM1054203 ,
GSM1054204 ,
GSM1054205 ,
GSM1054206 ,
GSM1054207 ,
GSM1054208 ,
GSM1054209 ,
GSM1054210 ,
GSM1054211 ,
GSM1054212 ,
GSM1054213 ,
GSM1054214 ,
GSM1054215 ,
GSM1054216 ,
GSM1054217 ,
GSM1054218 ,
GSM1054219 ,
GSM1054220 ,
GSM1054221 ,
GSM1054222 ,
GSM1054223 ,
GSM1054224 ,
GSM1054225 ,
GSM1054226 ,
GSM1054227 ,
GSM1054228 ,
GSM1054229 ,
GSM1067251 ,
GSM1067252 ,
GSM1067253 ,
GSM1067254 ,
GSM1068568 ,
GSM1068569 ,
GSM1068570 ,
GSM1068571 ,
GSM1068572 ,
GSM1068573 ,
GSM1068574 ,
GSM1068575 ,
GSM1068576 ,
GSM1068577 ,
GSM1068578 ,
GSM1068579 ,
GSM1068580 ,
GSM1068581 ,
GSM1068582 ,
GSM1068583 ,
GSM1068584 ,
GSM1068585 ,
GSM1068586 ,
GSM1068587 ,
GSM1068588 ,
GSM1068589 ,
GSM1068590 ,
GSM1068591 ,
GSM1068592 ,
GSM1068593 ,
GSM1068594 ,
GSM1068595 ,
GSM1068596 ,
GSM1071632 ,
GSM1071633 ,
GSM1071634 ,
GSM1071635 ,
GSM1071636 ,
GSM1071637 ,
GSM1071638 ,
GSM1071639 ,
GSM1071646 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (233)
GSE26190 Dominant Th2 differentiation of human regulatory T cells upon loss of FOXP3 expression
GSE29207 Role of miR-30 miRNAs during adipogenesis
GSE30039 Programming human pluripotent stem cells into adipocytes [Agilent]
GSE30041 Programming human pluripotent stem cells into adipocytes
GSE32033 Spt6 Levels are Modulated by PAAF1 and 26S Proteasome to Regulate the HIV-1 LTR and a Subset of Cellular Genes involved in Cancer.
GSE32064 Gene expression signatures in GIST-T1 cells transfected with siRNA targeting HOTAIR
GSE32385 Human PC-3 prostate cancer cells: Control (shNTC; non-target shRNA) vs. shETV4 knock down (shETV4)
GSE33872 Human fetal chylothorax: pleural fluid vs. ascites fluid
GSE34815 Impact of miR-199-5p overexpression and CAV1 silencing on human lung fibroblasts
GSE34818 MiR-199a-5p determines fibroblast activation and pulmonary fibrogenesis
GSE34989 A high-throughput screen to study the role of stem cells in hemangioma tumor formation
GSE35617 The invasion promoter Slug is a critical cell cycle regulator
GSE36951 Gene expression profiles of head and neck squamous cell carcinoma and renal cell carcinoma
GSE37119 Identification of target genes of cancer-related microRNAs in human cancer
GSE37361 Impact of Ino-C2-PAF on the gene expression profile of HaCaT cells after stimulation with pro-inflammatory cytokines
GSE37690 Differential analysis of HOXA1 in adult cells at isoform resolution by RNA-Seq [Agilent]
GSE37704 Differential analysis of gene regulation at transcript resolution by RNA-Seq
GSE38206 Transcription profiling of major depression peripheral blood mononuclear cells (PBMCs) at clinical remission compared to severe acute state
GSE38267 Gene expression profiling in blood of patients with chronic respiratory failure
GSE38302 Analysis of gene expression change by gefitinib treatment in gefitinib sensitive PC9 and resistant PC9.
GSE38626 Induced pluripotent stem cells from CINCA syndrome patients as a model for dissecting somatic mosaicism and drug discovery
GSE38766 Expression profile of human 786-O cells overexpressing Bcl-xAS lncRNA
GSE39035 Human bone marrow mesenchymal stem cells, young vs. old donors, early vs. late passages
GSE39183 Characterization of FASN knockdown LNCaP cells
GSE39761 CD8+ T cell gene expression after different antigen dose stimulations
GSE39768 Global analysis of genome, transcriptome and proteome reveals the response to aneuploidy in human cells
GSE39899 Gene expression profiling in B lymphocytes from transplanted patients
GSE40103 FLT3 activation cooperates with MLL-AF4 fusion gene to abrogate the hematopoietic specification of human ESCs
GSE40200 Human monocyte-derived DCs: effect of IL-4 superkines
GSE40711 Differences in cytokine production in human macrophages and in virulence in mice are attributable to the PA protein of H5N1 influenza viruses
GSE41760 Gene expression signatures in a human bladder cancer cell line SW780 transfected with miR-137 precursor molecule
GSE41951 Gene expression profile of the human leukemia cell line Reh after treatment with bortezomib, valproic acid or a combination of both.
GSE42148 Global gene expression profile of coronary artery disease in Asian Indians
GSE42493 Gene expression signatures in HuH7 cells transfected with super hybrid p53 version 2.
GSE42975 Novel dedifferentiated liposarcoma xenograft models reveal PTEN down regulation as a malignant signature and response to PI3K pathway inhibition
GSE42976 Effect of rBC2LCN on human embryonic stem cells
GSE43622 miR-210 promotes a hypoxic phenotype and increases radioresistance in human lung cancer cell lines.
GSE43698 Muscle from patients with mitochondrial myopathies and congenital muscular dystrophies versus normal human muscle
GSE43812 RhoE KD in U87 cells
GSE43815 ROCK1 KD in U87 cells
GSE43877 Long non-coding RNA HOTAIR is expressed in small cell lung cancer and is relevant to cellular proliferation, invasiveness and clinical relapse: tissue and cell-line analyses
GSE44700 C/EBPα induces highly efficient macrophage transdifferentiation of selected B-lymphoma /leukemia cell lines and impairs their tumorigenicity
GSE45032 Gene expression in liver of HCC and CHC patients
GSE45350 Genome-wide screening of the expression of long noncoding RNA and coding RNA expression in esophageal sqaumous cell cancer
GSE45385 Toll-like Receptor 6 and Connective Tissue Growth Factor are significantly upregulated in mitomycin-C treated urothelial carcinoma cells under hydrostatic pressure stimulation
GSE46809 The gene expression on human hair root
GSE46926 Genome-wide analysis of the effects of the novel mithramycin analogue DIG-MSK on human A2780 ovarian carcinoma cells
GSE47657 Differentially expressed genes by anti tumor treatment in human cancer cell lines
GSE47830 Uniform response to aneuploidy in human cells
GSE47836 Human colon carcinoma cell line treated with bafilomycin A1
GSE48578 Alteration of gene expression in human T cells treated with JPH203
GSE48873 Blood expression profiles of fragile X premutation carriers identify genes involved in neurodegenerative and infertility phenotypes [FXTAS]
GSE48903 Blood expression profiles of fragile X premutation carriers identify genes involved in neurodegenerative and infertility phenotypes
GSE49236 Gene expression of T47D-MTVL human breast cancer cells growing in normal conditions
GSE49345 Genomic distribution of human histone H1 subtypes
GSE49922 Primary term human trophoblasts exposed to ionizing irradiation
GSE49924 Irradiation of human and mouse placental cells
GSE50631 Human epidermal stem cell function is regulated by circadian oscillations
GSE50734 TEL-AML1 (ETV6-RUNX1) in B-cells and leukemia (part 5)
GSE50736 TEL-AML1 (ETV6-RUNX1) in B-cells and leukemia
GSE50758 Gene expression from pericytes and endothelial cells
GSE50900 Gene profiling of the zone of altered morphology of choriodecidua overlying the cervix before labor
GSE50901 Expression profiling identifies deregulated pathways and top diagnostic markers in papillary thyroid carcinoma
GSE51575 mRNA Expression Profiling in EBV-postive Gastric Carcinoma and EBV-negative GC in comparison with their normal mucosa tissue
GSE52162 Function of chemokine (CXC motif) ligand 12 in periodontal ligament fibroblasts
GSE52302 Comparison of gene expression (hESC, PGC-like cell from hESC, SSC from testis)
GSE52612 Forkhead Box F1 (FOXF1) represses fibroblast functions relevant to fibrogenesis
GSE53116 GENE TARGETS OF PALMITATE, OLEATE AND THEIR MIXTURE IN CULTURED LHCN-M2 MYOTUBES
GSE53651 CD7 promotes extramedullary involvement of the B-cell acute lymphoblastic leukemia line Tanoue by enhancing integrin beta2-dependent cell adhesiveness
GSE53703 Identification of a novel E-box binding PI polyamide inhibiting MYC-driven cell-proliferation
GSE54521 Genes induced during sebocyte differentiation
GSE54540 TIA proteins drives global and specific translational repression of genes linked to the cell-cycle progression and DNA replication/repair
GSE54942 Identification of target genes regulated by ΔNp63α in SaOS-2 cells stably expressed with ΔNp63α
GSE55108 Loss of immunosuppressive and anti-inflammatory properties in transformed human mesenchymal stem cells
GSE55258 Th17, Th22 and Treg cells are enriched in the healthy human cecum
GSE55428 Effect of FGFC on human embryonic stem cells
GSE55654 Transcriptomic profiling of granulosa and cumulus cells for prediction of successful embryo implantation in human in-vitro fertilization procedures
GSE55833 Comparative gene expression profiling of cutaneous B cell lymphomas
GSE56256 Influence of hexafluoro-2-propanol (HFIP) on lipopolysaccharides-induced inflammation in human microvascular endothelial cells of the lung
GSE56386 Understanding molecular mechanisms of Cetuximab insensitivity in Colorectal Cancer (CRC)
GSE56540 Comparison of gene expression in radio-resistant and radio-sensitive patient-derived spheroid cultures of small cell carcinoma of the cervix
GSE56564 Induced expression of the C19MC miRNAs in HTR-8/SVneo cells (mRNA)
GSE56565 Induced expression of the C19MC miRNAs in HTR-8/SVneo cells
GSE56595 Significance of SALL4 as a drug resistant factor in lung cancer
GSE56881 Gene expression profile of DLL4+ and DLL4- Hemato-Endothelial Progenitors (HEPs) subpopulations
GSE57764 Gene expression analysis of stimulated primary ASM cells [mRNA]
GSE57766 Gene expression analysis of stimulated primary ASM cells
GSE57964 Gene expression from pericytes
GSE58336 NQO1 regulates inflammatory signaling
GSE58389 Cyclic mechanical stretch-induced gene expression
GSE59049 Transcriptome profile of human pancreatic beta cell line (EndoC-βH2 ) following knockdown of RFX6.
GSE59246 Molecular features of subtype-specific progression from ductal carcinoma in situ to invasive breast cancer [gene expression data]
GSE59248 Molecular features of subtype-specific progression from ductal carcinoma in situ to invasive breast cancer
GSE59471 Cyr61 promotes CD204 expression and migration of macrophages via MEK/Erk pathway in the microenvironment of human esophageal squamous cell carcinoma
GSE59686 Gene profiling of the zone of altered morphology of choriodecidua overlying the cervix before labor in preterm samples
GSE60016 Gene expression of metabolically adaptable triple-negative breast cancer cells
GSE60017 Gene expression microarray and CGH array of metabolically adaptable cells derived from SUM149 triple-negative Inflammatory Breast Cancer cell line
GSE60458 Expression profiles of pheochromocytoma and paraganglioma
GSE60459 Expression and copy number profiles of pheochromocytoma and paraganglioma
GSE61017 Gene expression profile of HoxA9 over expressing and empty vector (EV) control Hemato-Endothelial Progenitors (HEPs) subpopulations
GSE61078 Development of gene expression signatures for miR-340 overexpressing human glioma-initiating cells (GICs)
GSE61228 Effects of Long-term Serial Passaging on the Characteristics and Properties of Cell Lines Derived From Uveal Melanoma Primary Tumors.
GSE61570 Human Neonate CD8-T cells are biased towards innate immunity defense mechanisms
GSE62021 Prediction of prognosis for small cell lung cancer based on genome-wide methylation analyses with surgical materials and robust clustering methods
GSE62075 Characterization of the human a9 integrin subunit gene: promoter analysis and transcriptional regulation
GSE62097 CD161 defines a transcriptional and functional phenotype shared across distinct human T cell lineages (TCRgd)
GSE62099 CD161 defines a transcriptional and functional phenotype shared across distinct human T cell lineages
GSE62146 Rapid neurogenesis through transcriptional activation in human stem cell (Agilent)
GSE62484 T-bet recruits P-TEFb to super-enhancers to regulate T helper cell differentiation (Agilent 1)
GSE62486 T-bet recruits P-TEFb to super-enhancers to regulate T helper cell differentiation
GSE62738 Twist1 knockdown in two gastric cancer-associated fibroblast lines
GSE62739 Twist1 gain-of-function studied in 2 normal gastric fibroblast lines
GSE62740 Twist1 is a key regulator for cancer-associated fibroblasts
GSE62766 Gene expression of T47D-MTVL human breast cancer cells upon H1X knock-down
GSE63534 Transcriptome profiling of TALEN-mediated LATS2 knockout HeLa-S3 cells
GSE63538 LATS2 regulates repressive epigenetic integrity via regulation of Polycomb repressive complex 2
GSE63593 Gene expression profiling of A549 human lung cancer cell line treated with allosteric inhibitors targeting atypical PKCs
GSE63962 Lung cell responses to ship diesel exhaust particles
GSE64119 Insights into the combined action of SAHA (vorinostat) and Mithramycin A in Sézary cells through gene expression profiling
GSE64430 Effect of cajanin stilbene acid and its synthetic derivatives on MCF-7 breast cancer cells
GSE64794 Type I interferon regulates the expression of long non-coding RNAs [expression array]
GSE64796 Type I interferon regulates the expression of long non-coding RNAs
GSE64831 Peripheral regions and central regions from HT-29 tumors
GSE64873 Chronic growth factor signaling in Acute Myeloid Leukemia is connected to a specific chromatin signature [Agilent]
GSE64874 Chronic growth factor signaling in Acute Myeloid Leukemia is connected to a specific chromatin signature
GSE64875 Global re-wiring of p53 transcription regulation by the hepatitis B virus X (HBx) protein [Agilent]
GSE64878 Global re-wiring of p53 transcription regulation by the hepatitis B virus X (HBx) protein
GSE65239 Transcriptomics of circulating human eosinophils
GSE65419 Transcriptional profiling of drug-tolerant cancer cell subpopulations
GSE65421 Functional impact of collagens on the activity directed by the promoter of the a5 integrin subunit gene in corneal epithelial cells
GSE66673 Identification of genes regulated during passaging of human osteosarcoma cell lines
GSE66675 Identification of genes regulated during passaging of human and mouse osteosarcoma cell lines
GSE66904 Human OCI-AML3 cells: Control vs. Atg5-shRNA or NPM1-shRNA inducibly expressed
GSE66921 Transcriptional profiling of subcutaneous adipose tissue of morbidly obese subjects before and after 2 years of bariatric surgery.
GSE67762 Tissue-engineered human psoriatic skin as an in vitro model to study the impact of cytokines
GSE67901 Expression dynamics in mammalian cells responding to protein misfolding stress
GSE68562 Effect of a JAK inhibitor on gene expression of HUT78 cell line
GSE68923 Gene expression in healthy and lesional psoriatic epidermis from human skin biopsies (laser capture microdissection): set 1
GSE68924 Gene expression in healthy and lesional psoriatic dermis from human skin biopsies (laser capture microdissection): set 1
GSE68937 Gene expression in healthy and lesional psoriatic epidermis from human skin biopsies (laser capture microdissection): set 2
GSE68939 Gene epression in healthy and lesional psoriatic dermis from human skin biopsies (laser capture microdissection): set 2
GSE70561 TYRP1 knock-down in human melanoma cell line (501Mel)
GSE70627 Notch1 Signaling Regulates the Aggressiveness of Differentiated Thyroid Cancer and Inhibits SERPINE1 Expression
GSE70947 Age and estrogen-dependent inflammation in breast adenocarcinoma and normal breast tissue [cohort_2]
GSE70951 Paired Breast Adenocarcinoma and Adjacent Normal tissue
GSE71727 Fibroblast transcription pattern in Salmonella infected Vs uninfected cells
GSE72676 Co-expression networks in generation of induced pluripotent stem cells
GSE72905 Cellular and molecular response to ruthenium(II)-arene complex with substituted picolinato ligand in HeLa cells
GSE73281 Targeting Non-proteolytic Protein Ubiquitination for the Treatment of Diffuse Large B Cell Lymphoma (Agilent Arrays)
GSE73410 Diversity in Modulation of Interferon Stimulated Genes by Dobrava, Kurkino, and Sochi Genotypes of Dobrava-Belgrade Hantavirus in comparison to Tula Virus
GSE73682 Development of gene expression signatures for knockdown of synthetic lethal gene
GSE74418 Gene expression profiles of prostate cancer cell line with or without HDAC inihbitors
GSE75336 The tissue-engineered human cornea as a model to study expression of matrix metalloproteinases during corneal wound healing
GSE75494 Transcriptional profiling of human ovarian cancer cells treated with ribonucleases
GSE75545 Urine-sample-derived human induced pluripotent stem cells as a model to study PCSK9-mediated autosomal dominant hypercholesterolemia
GSE75782 C3A Cells: Exposure vs Control [two-channel arrays]
GSE75783 C3A Cells: Exposure vs Control [one-channel arrays]
GSE75784 Mode of toxic action assignment of chemicals
GSE75867 Transient activation of the WNT pathway after disruption/remodeling of colorectal cancer cell clusters promotes a malignant phenotype
GSE76050 Human Papillary thyroid cancer cell line, BCPAP control vs. miR-146b-5p mimic transfected
GSE76405 Generation of a monoclonal antibody recognizing the CEACAM glycan structure and inhibiting adhesion using cancer tissue-originated spheroid as an antigen
GSE77122 Involvement of β-defensin 130 (DEFB130) in the macrophage microbicidal mechanisms for killing Plasmodium falciparum
GSE79302 Analysis of Sox2-regulated transcriptome in glioma stem cells
GSE79496 DMSO-free chemically defined cryopreservation of human mesenchymal stem cells and chondrocytes
GSE83626 Molecular classification of primary cultures of glioblastoma multiforme
GSE83654 Microarray Analysis of DU 145, LNCaP and PC-3 Prostate Cancer Cell Lines upon Docetaxel treatment
GSE84981 Information-dependent Enrichment Analysis Reveals Time-dependent Transcriptional Regulation of the Estrogen Pathway of Toxicity
GSE86789 Differential responses of choroidal melanocytes and uveal melanoma cells to low oxygen conditions
GSE86915 Transcription of the human 5-Hydroxytryptamine receptor 2B (HTR2B) gene is under the regulatory influence of the transcription factors NFI and RUNX1 in human uveal melanoma
GSE89455 Proliferation pause as an early blockade of human cellular reprogramming toward pluripotency
GSE89652 Specific normalization of urinary mRNAs reveals genome-wide patterns associated with renal allograft subclinical injury
GSE90460 A Curcumin-Based CBP HAT Inhibitor Modulates the Transcription Functions of Tumor Suppressor p53
GSE90564 Paclitaxel resistance in triple negative breast cancer involves novel functional genomic aberrations in the ABCB1 gene.
GSE91047 Regulated gene expression for breast cancer cells treated with NLC-Citral for 48 hours
GSE92573 Analysis of gene expression in colorectal cancer cells with DGKG overexpression
GSE93557 Lung cell responses to wood combustion aerosols
GSE94557 Whole blood gene expression from lung transplanted patients with chronic lung allograft dysfunction
GSE96665 Integrated analysis Of Biopsies From Inflammatory Bowel Disease Patients Identifies SAA1 As A Link Between Mucosal Microbes With TH17 And TH22 Cells [diseased subjects]
GSE97011 Genome wide transcriptional profiles of biopsies collected from non-IBD control subjects
GSE97012 Integrated Analysis Of Biopsies From Inflammatory Bowel Disease Patients Identifies SAA1 As A Link Between Mucosal Microbes With TH17 And TH22 Cells
GSE97498 Comparison of the RNA expression profiles of CD14+ monocytes from human peripheral blood with derived macrophages (MACs) and osteoclasts (OCs) obtained by exposure with M-CSF and M-CSF/RANKL, respectively, during 5 and 20 days
GSE98702 CD161 defines a distinct subset of pro-inflammatory NK cells that are present in the inflamed gut
GSE98727 Identification of p53-regulated genes in breast epithelial cells using MCF10A with wild-type p53 or p53-null
GSE100107 Long non-coding RNA HOTAIR promotes cell migration by upregulating insulin growth factor-binding protein 2 in renal cell carcinoma
GSE100361 Gene expression of native Jurkat human leukemia cell line following 8h Brd4 inhibition by MMQO
GSE100362 Gene expression of native Jurkat human leukemia cell line following 3h BET inhibition by MMQO or 3h HDAC inhibition by TSA
GSE103302 Stable recombinant MCF7 human breast cancer cell lines with inducible expression of CFP (NM_002621.2, RecCFP) or a mutated CFP variant (S27X, RecCFPm) vs. recombinant MCF7 control recombinants expressing an empty expression vector (RecCtrl)
GSE104110 Transcriptional profile of human neonatal cord blood and adult peripheral blood dendritic cells
GSE107162 Application of the transcriptomic biomarker, TGx-DDI, in genotoxicity screening
GSE109318 Transcriptomic analysis of HCT116 cells cultured under different oxygen conditions
GSE110799 Effect of IL-13 on transcriptome of differentiated human airway mucociliary epithelium
GSE111053 Gene expression in uninvolved and involved epidermis from patients with atopic dermatitis (laser capture microdissection): set 1
GSE111054 Gene expression in uninvolved and involved epidermis from patients with atopic dermatitis (laser capture microdissection): set 2
GSE111055 Gene expression in uninvolved and involved lesional epidermis from human skin biopsies from patients with atopic dermatitis (laser capture microdissection)
GSE112039 Gene expression in Fuchs endothelial corneal dystrophy and healthy cultured cells
GSE118141 CD271 is preferentially expressed and essential for cell proliferation in squamous cell carcinoma of the lung
GSE119063 human pituitary and prolactinoma
GSE120464 The Tissue-Engineered Human Psoriatic Skin Substitute: A Valuable In Vitro Model to Identify Genes with Altered Expression in Lesional Psoriasis
GSE122885 Gene expression of cultured human choroidal stromal fibroblasts and retinal pigment epithelial (RPE) cells
GSE122925 Genome-wide gene expression analysis in treatment for 24 h with 40 μM APR-246 in ARID1A-WT and ARID1A-KO HCT116 cells.
GSE122926 Genome-wide gene expression analysis in ARID1A-proficient and ARID1A-deficient cancer cells
GSE124042 Yarrow and marigold extracts and their effect in pancreatic cancer cells [CAL]
GSE124043 Yarrow and marigold extracts and their effect in pancreatic cancer cells [MIL]
GSE124044 Yarrow and marigold extracts and their effect in pancreatic cancer cells
GSE125429 Gene expression of chronically UVA1-irradiated human dermal diploid fibroblasts
GSE125787 Identification of p53-regulated genes in wild-type p53 or p53-null HCT116 cells
GSE129640 Multi-walled carbon nanotube-induced gene expression in vitro
GSE132855 Foodomics study on the anti-proliferative activity mechanisms on HT-29 colon cancer cells in response to golden berry (Physalis peruviana L.) calyx extracts
GSE133686 Foodomics study on the anti-proliferative activity mechanisms on HT-29 colon cancer cells in response to banana passion fruit (Passiflora mollissima) seeds PLE-extract
GSE136545 Human lymphoma cells: BLS type vs. conventional diffuse large B-cell lymphoma (DLBCL)
GSE136595 Estrogen-like effects of arsenite and cadmium
GSE136625 Time-resolved RNA atlas of early human T cell activation (mRNA)
GSE136741 BEX2 suppresses mitochondrial activity and is required for dormant cancer stem cell maintenance in intrahepatic cholangiocarcinoma
GSE139656 Gene expressions of IBMX-induced neuron differentiation from placenta-derived multipotent stem cells
GSE141841 Gene expression of human corneal epithelial cells grown with irradiated human fibroblasts or irradiated mouse 3T3 feeder layer .
GSE143153 Microarray analysis of salivary gland CD4+ T cells
GSE145959 microarray Analysis of MKN-45 cell lines after 48 hours post-transfection of miR-125b mimic (50nM) and mimic control.
GSE149415 The regulation and pharmacological modulation of immune complex induced type III IFN production by plasmacytoid dendritic cells [microarray]
GSE149456 The regulation and pharmacological modulation of immune complex induced type III IFN production by plasmacytoid dendritic cells
GSE154841 BLCAP knockdown HEK293 cells: shLuc vs. shBLCAP
GSE167225 Allergen-specific immunotherapy induces the suppressive secretoglobin 1A1 in cells of the lower airways
GSE171660 Novel Peripheral Blood Allergen Stimulation Test for Non-IgE-mediated Gastrointestinal Food Allergies in Neonates and Infants.
GSE172573 TGF-β modulation of cell-cell and cell-extracellular matrix interactions in post-confluent corneal endothelial cells
GSE180775 Recurrence biomarkers of triple negative breast cancer treated with neoadjuvant chemotherapy combined with anti-EGFR antibodies [Agilent]
GSE181610 PCSK9 is involved in human induced pluripotent stem cell proliferation through the regulation of the NODAL signaling pathway II
GSE183594 Gene expression in human keratinocytes cultivated with serum-free medium and serum containing medium
GSE183599 Gene expression in human corneal epithelial cells without or with Wnk inhibitor
GSE183603 Gene expression in commercial human cerebral microvascular endothelial cells (hCMECs) line knock out or not for RNF213
GSE185399 Effect of the primed exposure of Diesel CAST model aerosol in air-liquid interface BEAS-2B cells exposed to native birch pollen
GSE185459 Gene expression in human corneal epithelial cells (hCECs) with different post-mortem intervals and cultivated in monoculture or used for human tissue‐engineered corneas (hTECs)
GSE196949 Lung epithelial CYP1 activity regulates aryl hydrocarbon receptor dependent allergic airway inflammation
GSE206311 Gene expression in human keratinocytes from psoriatic skin (directly into the lesion or in area without lesion) or healthy person (control) used for human tissue-engineered skin substitutes and co-cultured with T-lymphocyte
GSE215102 Gene expression in human corneal epithelial cells (hCECs), human corneal fibroblasts (hCFs) or human corneal endothelial cells (hCEnCs) with or without exosomes derived from hCECs, hCFs or hCEnCs
Relations Alternative to
GPL14550 Alternative to
GPL24914 (GeneName version)
Data table header descriptions ID Agilent Feature Number
ProbeName GB_ACC GenBank or RefSeq accession
ControlType accessions GeneName Description chr_coord SEQUENCE Sequence of oligonucleotide
SPOT_ID
Data table ID ProbeName GB_ACC ControlType accessions GeneName Description chr_coord SEQUENCE SPOT_ID 1
GE_BrightCorner
1
GE_BrightCorner
--GE_BrightCorner
2
DarkCorner
1
DarkCorner
--DarkCorner
3
DarkCorner
1
DarkCorner
--DarkCorner
4
A_23_P326296
NM_144987 0
ref|NM_144987|ref|NM_001040425|ens|ENST00000292879|ens|ENST00000392196
U2AF1L4
ref|Homo sapiens U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4), transcript variant 2, mRNA [NM_144987]
hs|chr19:036235296-036235237
GTATGGGGAGATTGAAGAGATGAATGTGTGCGACAACCTTGGGGACCACGTCGTGGGCAA
5
A_24_P287941
NM_013290 0
ref|NM_013290|ref|NM_016556|ens|ENST00000393795|ens|ENST00000253789
PSMC3IP
ref|Homo sapiens PSMC3 interacting protein (PSMC3IP), transcript variant 1, mRNA [NM_013290]
hs|chr17:040724775-040724716
AAATTGCAGTAGCTTGAGGTTAACATTTAGACTTGGAACAATGCTAAAGGAAAGCATTTG
6
A_24_P325046
0
ens|ENST00000322831|gb|AK126219
ENST00000322831
ens|Zinc finger CCHC domain-containing protein 7 [Source:UniProtKB/Swiss-Prot;Acc:Q8N3Z6] [ENST00000322831]
hs|chr9:37186845-37186904
TGCACCTACTCTGTAACCTAACTGCGATTTATAAAATGAAACAATCTCTTCTAATTTGGC
Ensembl:ENST00000322831
7
A_23_P200404
NM_001625 0
ref|NM_001625|ens|ENST00000354858
AK2
ref|Homo sapiens adenylate kinase 2 (AK2), transcript variant AK2A, mRNA [NM_001625]
hs|chr1:033478807-033478748
GTAAAGACTTGGTTATGTTTATCTAATGTTGGGTCCAAGAAGGAATTTCTTTCCATCCCT
8
A_19_P00800513
0
lincRNA:chr7:226042-232442_R
lincRNA:chr7:226042-232442 reverse strand
hs|chr7:226498-226439
GGACAGCGACTCCCTCCTCCCTGAGCCTTGGGCCCTCGTCCTTGGCTGGTAAGCGCTGGG
lincRNA
9
A_23_P15619
NM_032391 0
ref|NM_032391|ens|ENST00000290294|gb|BG611169
PRAC
ref|Homo sapiens prostate cancer susceptibility candidate (PRAC), mRNA [NM_032391]
unmapped
GCCCATCTTACTACCTCCAAGAGTGCTTTTCTCTCTAATAAGAAAACATCTACTTTGAAA
10
A_33_P3402354
0
ens|ENST00000238571|ens|ENST00000423680
ENST00000238571
ens|YLP motif-containing protein 1 (Nuclear protein ZAP3)(ZAP113) [Source:UniProtKB/Swiss-Prot;Acc:P49750] [ENST00000238571]
hs|chr14:75287841-75287900
GTAGGAGACAGACCAACCACTTTGAACAGTGTCTCTTTATTAAAATTCTTAAAGAAGGTT
Ensembl:ENST00000238571
11
A_33_P3338798
NM_001145251 0
ref|NM_001145251|ens|ENST00000444271
SDR16C6
ref|Homo sapiens short chain dehydrogenase/reductase family 16C, member 6 (SDR16C6), mRNA [NM_001145251]
hs|chr8:057285688-057285629
CTTTCAAAGGGAGAAAGAAAGCAAATGAACTTCAGACTGAAACTGAAGGGAAACACCAGT
12
A_32_P98683
NM_005937 0
ref|NM_005937|ens|ENST00000325718
MLLT6
ref|Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (MLLT6), mRNA [NM_005937]
hs|chr17:036885675-036885734
TGAGGGGTGCCTTCATTCCCCTTTGTTCACTTTCTCCAGCTCAACTTGGGACTTGGGTGG
13
A_23_P137543
NM_152493 0
ref|NM_152493|ens|ENST00000373428
ZNF362
ref|Homo sapiens zinc finger protein 362 (ZNF362), mRNA [NM_152493]
hs|chr1:033765985-033766044
ACTCCCTGTAAATACGCTGTTATACATACTGTTAACACCCCTTTGCTTTTTCTATGGGAC
14
A_19_P00803040
0
lincRNA:chr8:104254399-104295074_F
lincRNA:chr8:104254399-104295074 forward strand
hs|chr8:104258569-104258628
CACTGTGGGCTCTCCCCTTCCTCTGGGGAAAATTTGTTTCATCAAGGTTATTTCTTTGTT
lincRNA
15
A_23_P117852
NM_014736 0
ref|NM_014736|ref|NM_001029989|ens|ENST00000380258|ens|ENST00000300035
KIAA0101
ref|Homo sapiens KIAA0101 (KIAA0101), transcript variant 1, mRNA [NM_014736]
hs|chr15:064657906-064657847
TACTGCTGCCATTTTTATTGGTGTTTGATTATTGGAATGGTGCCATATTGTCACTCCTTC
16
A_33_P3285585
XR_041134 0
ref|XR_041134|ref|XR_041135|ref|XR_041136
FLJ45256
ref|PREDICTED: Homo sapiens hypothetical LOC400511 (FLJ45256), miscRNA [XR_041134]
hs|chr16:024674226-024674167
TAAGAGTTTGAGCATGTATGTGTGTGTGCATATACACCAGCACACACATGCATGCCCACA
17
A_24_P328231
NM_017871 0
ref|NM_017871|ens|ENST00000430786|ens|ENST00000429572|ens|ENST00000434694
CPSF3L
ref|Homo sapiens cleavage and polyadenylation specific factor 3-like (CPSF3L), mRNA [NM_017871]
hs|chr1:001254802-001254743
CATCTTGCTGGAGGACTACCGCAAGATCGCCGTAGACAAGAAGGGCGAGGCCAACTTCTT
18
A_33_P3415668
NR_028328 0
ref|NR_028328|ens|ENST00000299326|tc|NP1472485
LOC643923
ref|Homo sapiens hypothetical protein LOC643923 (LOC643923), non-coding RNA [NR_028328]
hs|chr11:107463877-107463936
CTTCTGCAAGGCTGTTAGTAAGGATACTATGTATTGCTGTGCTTGATTAATGAAGAAAAT
19
A_23_P73609
NM_000266 0
ref|NM_000266|ens|ENST00000378062
NDP
ref|Homo sapiens Norrie disease (pseudoglioma) (NDP), mRNA [NM_000266]
hs|chrX:043808897-043808838
ATGCTTGTTGACAGAGAGAGATACTCTGGGAACTTCTTTGCAGTTCCCATCTCCTTTCTC
20
A_24_P186124
NM_182501 0
ref|NM_182501|ens|ENST00000391980
MTERFD2
ref|Homo sapiens MTERF domain containing 2 (MTERFD2), transcript variant 1, mRNA [NM_182501]
hs|chr2:242035047-242034988
TCCGGTTCAGGAATCACTATGTATTTCCTTCTTGTGATAAAAATAAAATTACGAGAAGGC
62976 15136 Kbytes .Supplementary file Size Download File type/resource GPL13607_old_annotations.txt.gz
5.0 Mb
(ftp) (http) TXT
Less...
More...