|
| Status |
Public on Jul 22, 2014 |
| Title |
Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by array
|
| Summary |
Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls.
For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen):
Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC
Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC
Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC
Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT
miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT
Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions.
Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).
|
| |
|
| Overall design |
Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
|
| |
|
| Contributor(s) |
deCarvalho AC, Poisson LM, Cherba D, Berezovsky AD, Webb C, Transou AD, Hong X, Hasselbach L, Irtenkauf SM, Mikkelsen T |
| Citation(s) |
24726753 |
| |
| Submission date |
Oct 18, 2013 |
| Last update date |
Aug 13, 2018 |
| Contact name |
David Cherba |
| E-mail(s) |
david.cherba@vai.org
|
| Phone |
616 234 5382
|
| Organization name |
Van Andel Institute
|
| Department |
Bioinformatics and Biostatistic Core
|
| Street address |
333 Bostwick Ave
|
| City |
Grand Rapids |
| State/province |
MI |
| ZIP/Postal code |
49503 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL10558 |
Illumina HumanHT-12 V4.0 expression beadchip |
|
| Samples (8)
|
|
| Relations |
| BioProject |
PRJNA223175 |
Less...
More...