 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 05, 2012 |
| Title |
WT_H3K4me3_ChIPSeq |
| Sample type |
SRA |
| |
|
| Source name |
Yeast
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
genotype/variation: WT
antibody: H3K4me3 (Abcam, mAbcam1012, lot 1152779)
growth_stage: logarithmic
|
| Treatment protocol |
1% formaldehyde crosslinking
|
| Growth protocol |
Yeast strains were grown to midlog and crosslinked with 1% formaldehyde for 15 minutes
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were lysed by bead beating and mononucleosomes were generated through Mnase digestion
Library construction for the Illumina platform was prepared using a custom procedure for paired-end sequencing (Illumina). Briefly, 2-10 ng of ChIP material was end-repaired and A-tailed before being ligated to TruSeq PE adaptors. The resulting material was then amplified using TruSeq PE PCR primer 1.0 and custom indexed multiplexing primers [5' AAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 3'], where "NNNNNN" corresponds to unique hexamer barcodes. PCR amplification was performed as follows: denaturation at 98°C for 60 seconds; 8 cycles of (98°C, 30 seconds; 65°C, 30 seconds; 72°C, 30 seconds), and a final extension at 72°C for 5 minutes. An aliquot of each library was run on an Agilent High Sensitivity chip (Agilent) to check the size distribution and molarity of the PCR products. Equimolar amounts of indexed, amplified libraries were pooled, and fragments in the 200-600 bp size range were selected on an 8% Novex TBE PAGE gel (Invitrogen). The pooled libraries were diluted to 15 nM. Libraries were sequenced on the Hiseq2000 (SBSxx) platform. The hexamer barcode was sequenced using the following primer [5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3']. Image analysis, base-calling and error calibration was performed using Illumina's Genome analysis pipeline.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Image analysis, base-calling and error calibration was performed using Illumina’s Genome analysis pipeline
Reads were aligned using Burrows-Wheeler Aligner
Aligned reads were imported into SeqMonk
Duplicate reads removed
Reads mapping to longer than 500bp were discarded
Read quantitation performed using a wiggle plot with 1 base pair probes
Data normalized to reflect bulk levels of K4me3 present in each strain
Data track exported as Bedgraph file
Genome_build: S. cerevisiae Apr. 2011 (SacCer_Apr2011/sacCer3) (sacCer3)
Supplementary_files_format_and_content: Bedgraph files, scores represent read quantitation
|
| |
|
| Submission date |
Oct 09, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Benjamin Martin |
| E-mail(s) |
bje.martin@gmail.com
|
| Organization name |
UBC
|
| Department |
Biochemistry
|
| Lab |
Howe
|
| Street address |
2350 Health Sciences Mall
|
| City |
Vancouver |
| State/province |
BC |
| ZIP/Postal code |
V6T 1Z3 |
| Country |
Canada |
| |
|
| Platform ID |
GPL13821 |
| Series (1) |
| GSE41424 |
Histone H3K4 Demethylation is Negatively Regulated by Histone H3 Acetylation in S. cerevisiae |
|
| Relations |
| SRA |
SRX193164 |
| BioSample |
SAMN01760480 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1016879_WT_K4me3.txt.gz |
45.7 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
