Yeast cultures were grown in 100 ml YP -ura -trp media with 1% raffinose and 50 mM CuSO4 at 27C with agitation until optical density of 0.8. Galactose was added to the media to 1% final concentration to induce UBR1 expression. After 1 hour of induction, the incubator was shifted to 37C to induce Sth1 protein degradation. After 2 hours of high temperature, cells were harvested. Cells were crosslinked for 5 minutes by addition of formaldehyde to 1% final concentration in the media and quenched by the addition of 1M glycine to 0.1M final concentration. Cells were harvested by centrifugation and washed twice with Tris-Buffered Saline. Cells were stored at -80C until preparation.
Extracted molecule
genomic DNA
Extraction protocol
Cells (equivalent to 50 ml culture) were suspended in spheroplasting solution (1M sorbitol, 10 mM Tris pH 7.5, 10 mM 2-MercaptoEthanol, protease inhibitors) and incubated with prepared zymolyase (Sigma) at 37C until the optical density of a 1:100 dilution in 1% SDS dropped to 0.01. Spheroplasts were gently harvested by low-speed centrifugation and stored on ice until ready. Spheroplasts were resuspended with MNase Digestion buffer (50 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.1% Triton X-100) and digested with MNase at 37C for 25 minutes. The amount of MNase was empirically determined to yield an estimated 60% mono-, 30% di-, and 10% tri-nucleosomes. MNase digestion was stopped by the addition of 0.1X volumes of stop solution (250 mM EDTA. 5% SDS). Proteinase K was added to the samples, incubated at 37C for 2 hours, and then 65C overnight to reverse cross links. Protein was precipitated from the samples by addition of 8M potassium acetate to 1.2M final concentration, cooling on ice, and centrifugation. DNA was recovered by ethanol precipitation. Mononucleosome DNA was isolated by RNAase treatment, electrophoresis on a 1.2% agarose gel, excision, and purification with a Qiagen Gel Extraction Kit.
Label
Cy3
Label protocol
ISW1 wildtype samples were amplified using PCR with a random primer. Mononucleosome DNA was denatured, incubated with a random primer (GTTTCCCAGTCACGATCNNNNNNNNN), and extended using Sequenase enzyme (US Biochemical) in the presence of dNTP. The reaction was denatured again and extended a second time with fresh Sequenase enzyme. A portion of the primed products was then amplified in a standard PCR reaction using the primer GTTTCCCAGTCACGATC and Platinum Taq (Invitrogen). For isw1 mutant samples, the mononucleosome DNA was amplified by ligation-mediated PCR. Mononucleosome DNA ends were polished using T4 kinase (NEB) and ligated to annealed primers AGAAGCTTGAATTCGAGCAGTCAG and CTGCTCGAATTCAAGCTTCT. The ligated product was then amplified using standard PCR reaction with primer CTGCTCGAATTCAAGCTTCT and Platinum Taq. After amplification, products were purified by Qiagen PCR cleanup columns and verified by gel electrophoresis. A normalized amount (3 µg) of amplified product was then labeled using Klenow enzyme, the respective PCR primer, 1 mM each of dATP, dTTP, dGTP, Cy3-dCTP or Cy5-dCTP, and 0.5 mM dCTP. Labeled products were purified using Qiagen PCR cleanup column with an additional 250 µl wash of 35% guanidine HCl.
Yeast cultures were grown in 100 ml YP -ura -trp media with 1% raffinose and 50 mM CuSO4 at 27C with agitation until optical density of 0.8. Galactose was added to the media to 1% final concentration to induce UBR1 expression. After 1 hour of induction, the incubator was shifted to 37C to induce Sth1 protein degradation. After 2 hours of high temperature, cells were harvested. Cells were crosslinked for 5 minutes by addition of formaldehyde to 1% final concentration in the media and quenched by the addition of 1M glycine to 0.1M final concentration. Cells were harvested by centrifugation and washed twice with Tris-Buffered Saline. Cells were stored at -80C until preparation.
Extracted molecule
genomic DNA
Extraction protocol
Cells (equivalent to 50 ml culture) were suspended in spheroplasting solution (1M sorbitol, 10 mM Tris pH 7.5, 10 mM 2-MercaptoEthanol, protease inhibitors) and incubated with prepared zymolyase (Sigma) at 37C until the optical density of a 1:100 dilution in 1% SDS dropped to 0.01. Spheroplasts were gently harvested by low-speed centrifugation and stored on ice until ready. Spheroplasts were resuspended with MNase Digestion buffer (50 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.1% Triton X-100) and digested with MNase at 37C for 25 minutes. The amount of MNase was empirically determined to yield an estimated 60% mono-, 30% di-, and 10% tri-nucleosomes. MNase digestion was stopped by the addition of 0.1X volumes of stop solution (250 mM EDTA. 5% SDS). Proteinase K was added to the samples, incubated at 37C for 2 hours, and then 65C overnight to reverse cross links. Protein was precipitated from the samples by addition of 8M potassium acetate to 1.2M final concentration, cooling on ice, and centrifugation. DNA was recovered by ethanol precipitation. Mononucleosome DNA was isolated by RNAase treatment, electrophoresis on a 1.2% agarose gel, excision, and purification with a Qiagen Gel Extraction Kit.
Label
Cy5
Label protocol
ISW1 wildtype samples were amplified using PCR with a random primer. Mononucleosome DNA was denatured, incubated with a random primer (GTTTCCCAGTCACGATCNNNNNNNNN), and extended using Sequenase enzyme (US Biochemical) in the presence of dNTP. The reaction was denatured again and extended a second time with fresh Sequenase enzyme. A portion of the primed products was then amplified in a standard PCR reaction using the primer GTTTCCCAGTCACGATC and Platinum Taq (Invitrogen). For isw1 mutant samples, the mononucleosome DNA was amplified by ligation-mediated PCR. Mononucleosome DNA ends were polished using T4 kinase (NEB) and ligated to annealed primers AGAAGCTTGAATTCGAGCAGTCAG and CTGCTCGAATTCAAGCTTCT. The ligated product was then amplified using standard PCR reaction with primer CTGCTCGAATTCAAGCTTCT and Platinum Taq. After amplification, products were purified by Qiagen PCR cleanup columns and verified by gel electrophoresis. A normalized amount (3 µg) of amplified product was then labeled using Klenow enzyme, the respective PCR primer, 1 mM each of dATP, dTTP, dGTP, Cy3-dCTP or Cy5-dCTP, and 0.5 mM dCTP. Labeled products were purified using Qiagen PCR cleanup column with an additional 250 µl wash of 35% guanidine HCl.
Hybridization protocol
Fluorescently labeled DNA samples were heat denatured after being combined with cot-1 DNA, Agilent aCGH blocking agent and Agilent Hi-RPM hybridization solution. Microarray hybridizations were performed using Agilent SureHyb Hybridization chambers. Hybridization chambers were loaded onto a rotisserie in an Agilent Hybridization Oven and were incubated at 65ºC for 24 hours with a rotational speed of 20 rpm. Following incubation, the microarray slide was washed for 5 minute in aCGH/ChIP-on-chip Wash Buffer 1 (0.5X SSPE, 0.005% N-lauroylsarcosine; room temperature) and 5 minute in aCGH/ChIP-on-chip Wash Buffer 2 (0.1X SSPE, 0.005% N-lauroylsarcosine; 31ºC). Microarray slides were briefly dipped in a solution of acetonitrile and dried.
Scan protocol
Fluorescently labeled DNA samples were heat denatured after being combined with cot-1 DNA, Agilent aCGH blocking agent and Agilent Hi-RPM hybridization solution. Microarray hybridizations were performed using Agilent SureHyb Hybridization chambers. Hybridization chambers were loaded onto a rotisserie in an Agilent Hybridization Oven and were incubated at 65ºC for 24 hours with a rotational speed of 20 rpm. Following incubation, the microarray slide was washed for 5 minute in aCGH/ChIP-on-chip Wash Buffer 1 (0.5X SSPE, 0.005% N-lauroylsarcosine; room temperature) and 5 minute in aCGH/ChIP-on-chip Wash Buffer 2 (0.1X SSPE, 0.005% N-lauroylsarcosine; 31ºC). Microarray slides were briefly dipped in a solution of acetonitrile and dried.
Description
Mononucleosomal DNA from RSC and rsc-null strains in ISW1 background, repeat 1-3 6185E1; 6186E1; 6190E1
Data processing
Raw feature intensities from three replicates were quantile normalized together, median scaled to 1, and the combined values converted to a log2 value. Probe sequences were mapped to Saccharoymyces cerevisisiae genome release 64 (UCSC sacCer3) and were then associated with the corresponding processed feature value. Processing was done with the BioToolBox (http://code.google.com/p/biotoolbox) programs process_microarray and map_oligo_data2gff.
