|
| Status |
Public on Aug 11, 2015 |
| Title |
DL4900 |
| Sample type |
SRA |
| |
|
| Source name |
bacterial cell lysates_RecA-ChIP-seq
|
| Organism |
Escherichia coli |
| Characteristics |
strain: K-12 MG1655
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχ mhpA::χχχ rph+
chip antibody: anti-RecA antibody
chip antibody vendor: Abcam
chip antibody cat.#: ab63797
|
| Treatment protocol |
Protein DNA interactions were crosslinked for 10 min at 22.5C with 1% formaldehyde and quenched using glycine to a final concentration of 0.5M
|
| Growth protocol |
Cells were grown in M9 minimal media supplemented with 0.2% casamino acids, 0.5% glucose 5μM CaCl2 and 1mM MgSO4 at 37°C to and OD600nm of 0.2-0.25
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were collected by centrifugation and washed three times in ice-cold 1X PBS. The pellet was then re-suspended in 250 μl ChIP buffer (200 mM Tris-HCl (pH 8.0), 600 mM NaCl 4% Triton X, Complete protease inhibitor cocktail EDTA-free (Roche)). Sonication of crosslinked samples was performed using the Diagenode Bioruptor® at 30s intervals for 10 min at high amplitude. After sonication, 350 μl of ChIP buffer was added to each sample, the samples were mixed by gentle pipetting and 100 μl of each lysate was removed and stored as ‘input’. Immunoprecipitation was performed overnight at 4°C using 1/100 anti-RecA antibody (Abcam, ab63797). IP samples were then incubated with Protein G Dynabeads® (Life Technologies) for 2 h at room temperature. All samples were washed 3 times with 1 X PBS + 0.02% Tween-20 before re-suspending the Protein G dynabeads in 200 μl of TE buffer (10 mM Tris (pH 7.4), 1 mM EDTA) + 1% SDS. 100 μl of TE buffer was added to the input samples and all samples were then incubated at 65°C for 10 h to reverse formaldehyde crosslinks. DNA was isolated using the MinElute PCR purification kit (Qiagen). DNA was eluted in 50 μl of TE buffer using a 2-step elution. Samples were stored at -20°C.
All samples were processed following NEB’s protocol from the NEBNext® ChIP-Seq library preparation kit.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Adaptor Sequences were removed using fastx_clipper. (http://hannonlab.cshl.edu/fastx_toolkit/index.html) - Example: fastx_clipper -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG -i DL4900_raw.fasta -o DL4900_clipped.fasta
Data collapsed using fastx collapser to remove identical sequencing reads (http://hannonlab.cshl.edu/fastx_toolkit/index.html) - Example: fastx_collapser -i DL4900_clipped.fasta -o DL4900_clip_clp.fasta
reads were mapped to the E. coli K12 MG1655 (NC000913.3) genome using Novoalign version 2.07 (www.novocraft.com) - Example: (novoalign -f DL4900_clip_clp.fasta -d NC000913.3.nix -r Random > DL4900.novo)
yPileup was used to generate count data for the whole genome - Example: pyPileup.py --file_type=novo -f DL4900.novo --tab=NC000913.3.tab --chr=Wholechom.txt.gz -- ignorestrand
Genome_build: Escherichia coli K12 MG1655 NC000913.3
Supplementary_files_format_and_content: txt files including count data for the whole genome
|
| |
|
| Submission date |
Jul 23, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Charlotte Anne Cockram |
| E-mail(s) |
ccockram@rockefeller.edu
|
| Organization name |
University of Edinburgh
|
| Department |
ICB
|
| Lab |
Leach Lab
|
| Street address |
Mayfield Road
|
| City |
Edinburgh |
| ZIP/Postal code |
EH9 3JR |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL14548 |
| Series (1) |
| GSE71249 |
Quantitative Genomic Analysis of RecA Protein Binding During DNA Double-Strand Break Repair Reveals RecBCD Action in vivo |
|
| Relations |
| BioSample |
SAMN03896116 |
| SRA |
SRX1116325 |
