 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 27, 2017 |
| Title |
piwi-ctrl |
| Sample type |
SRA |
| |
|
| Source name |
ovaries
|
| Organism |
Drosophila melanogaster |
| Characteristics |
genotype: vasa-GAL80[ts]/+;;da-GAL4/shpiwi
embryonic temperature: 18°C
|
| Growth protocol |
Flies were maintained at 18°C. After appropriate cross, embryos were shifted at 28°C to induce either RNAi against white or piwi proteins. For the piwi-ctrl experiments the embryos were raised at 18°C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Small RNAs (18-30nt) were isolated from ovaries by manual anion exchange chromatography procedure.
Extracted small RNAs were cloned by BGI (China) for white-embKD_rep2 and piwi-embKD_rep2 and by Donnelly sequencing center (Canada) for piwi-ctrl, white-embKD and Piwi-emb-KD after being selected on acrylamide gel between 18 and 30 nucleotides.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Manual anion-exchange chromatography (HiTrapQ column) purification
|
| Data processing |
Read mapping on D. melanogaster genome and canonical transposons: Sequenced reads were stripped of the adapter in the 3' end (TGGAATTCTCGGGTGCCAAG) and the retrieved small RNA reads (18-30nt) were mapped on D. melanogaster genome (version dm3) complemented by canonical transposable element (TE) sequences curated by Casey Bergman (available at https://github.com/cbergman). The mapping was done with bowtie2 using mismatch-tolerant parameters (-L 11 -i S,1,0.8 -N 1 --mp 4,2) and allowing up to 10 alignments for a given read (-k 10).
siRNA reads identification: Small RNA reads of 21 nucleotide long which did not map on miRNA, rRNA,snoRNA,tRNA,ncRNA
piRNA candidates identification: Small RNA reads of 23 to 30 nucleotide long which did not map on miRNA, rRNA,snoRNA,tRNA,ncRNA
piRNA candidate mapping on piRNA cluster and TE consensus sequence: To better quantify piRNA candidate origins, secondary mappings were performed on piRNA cluster and TE consensus sequences with bowtie2 using mismatch- and gap-tolerant parameters (-L 6 -i S,1,0.8 -N 1 --mp 4,2 --rdg 5,2 --rfg 5,2) and allowing up to 10 alignments for a given read (-k 10).
Genome_build: Drosophila melanogaster, release 5
Supplementary_files_format_and_content: The processed data files are in .txt format and consist in a file with siRNA reads and another with piRNA reads for each of the five analyzed libraries.
|
| |
|
| Submission date |
Jun 10, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
SEVERINE CHAMBEYRON |
| E-mail(s) |
severine.chambeyron@igh.cnrs.fr
|
| Organization name |
CNRS
|
| Department |
Institute of Human Genetics
|
| Lab |
Non-coding RNA, epigenetics and genome stability
|
| Street address |
141, rue de la Cardonille
|
| City |
MONTPELLIER |
| ZIP/Postal code |
34396 |
| Country |
France |
| |
|
| Platform ID |
GPL17275 |
| Series (2) |
| GSE83236 |
Piwi is required during Drosophila embryogenesis to license dual-strand piRNA clusters for transposon repression in adult ovaries [smallRNA-seq] |
| GSE83238 |
Piwi is required during Drosophila embryogenesis to license dual-strand piRNA clusters for transposon repression in adult ovaries |
|
| Relations |
| BioSample |
SAMN05226717 |
| SRA |
SRX1837304 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2197455_piwi_ctrl_21_on_D_melanogaster_siRNA_candidate_count.txt.gz |
380.6 Kb |
(ftp)(http) |
TXT |
| GSM2197455_piwi_ctrl_23-30_on_D_melanogaster_piRNA_candidate_count.txt.gz |
5.4 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
