NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2242257 Query DataSets for GSM2242257
Status Public on Oct 25, 2017
Title BCtoPr_Lib3
Sample type SRA
 
Source name Plasmid
Organism synthetic construct
Characteristics tissue: Plasmid
Extracted molecule other
Extraction protocol Qiagen-Midi
CRE-barcode sequences were amplified using Primer #2 and one of the Indexing primers (Primers #3-11) containing the Illumina flow cell annealing sequences. PCR products were purified using AmPure XP beads (Beckman Coulter, #A63880).
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina MiSeq
 
Description Barcode to promoter assignment
processed data file: BCtoPr_Lib3.tab
Data processing Library strategy: Parallel Reporter Assay
A custom pipeline was created to assign barcodes to each tested sequences. Then sequence activity was calculated as the ratio of barcode abundance in the RNA sample compare to its abundance in the AAV pool.
Sequences from Read1 starting with "TCCACTGGGAGAAGAGGAAGTCAAA" were aligned from position 55 on to the Mus Musculus genome (BSgenome.Mmusculus.UCSC.mm9) using Bowtie. Sequences from Read2 between “CGTTTAAACTGTCGACCGAGCT” and 'TTCGGCGCATG” were extracted as barcodes and the reverse complement was generated. barcodes and aligned reads were matched by read ID. Barcodes that were associated with one CRE or with a CRE that represents >90% of all reads of a barcode were used for the analysis, the rest was discarded.
processed data: Tab delimited, correspondance between the tested element and its barcode in each library
Genome_build: mm9
 
Submission date Jul 19, 2016
Last update date May 15, 2019
Contact name Dirk Schuebeler
Organization name Friedrich Miescher Institute for Biomedical Research
Street address Maulbeerstrasse 66
City Basel
ZIP/Postal code 4058
Country Switzerland
 
Platform ID GPL17769
Series (1)
GSE84589 Cis-regulatory landscape of four cell types of the retina
Relations
BioSample SAMN05417358
SRA SRX1960892

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap