|
Status |
Public on Oct 25, 2017 |
Title |
BCtoPr_Lib3 |
Sample type |
SRA |
|
|
Source name |
Plasmid
|
Organism |
synthetic construct |
Characteristics |
tissue: Plasmid
|
Extracted molecule |
other |
Extraction protocol |
Qiagen-Midi CRE-barcode sequences were amplified using Primer #2 and one of the Indexing primers (Primers #3-11) containing the Illumina flow cell annealing sequences. PCR products were purified using AmPure XP beads (Beckman Coulter, #A63880).
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina MiSeq |
|
|
Description |
Barcode to promoter assignment processed data file: BCtoPr_Lib3.tab
|
Data processing |
Library strategy: Parallel Reporter Assay A custom pipeline was created to assign barcodes to each tested sequences. Then sequence activity was calculated as the ratio of barcode abundance in the RNA sample compare to its abundance in the AAV pool. Sequences from Read1 starting with "TCCACTGGGAGAAGAGGAAGTCAAA" were aligned from position 55 on to the Mus Musculus genome (BSgenome.Mmusculus.UCSC.mm9) using Bowtie. Sequences from Read2 between “CGTTTAAACTGTCGACCGAGCT” and 'TTCGGCGCATG” were extracted as barcodes and the reverse complement was generated. barcodes and aligned reads were matched by read ID. Barcodes that were associated with one CRE or with a CRE that represents >90% of all reads of a barcode were used for the analysis, the rest was discarded. processed data: Tab delimited, correspondance between the tested element and its barcode in each library Genome_build: mm9
|
|
|
Submission date |
Jul 19, 2016 |
Last update date |
May 15, 2019 |
Contact name |
Dirk Schuebeler |
Organization name |
Friedrich Miescher Institute for Biomedical Research
|
Street address |
Maulbeerstrasse 66
|
City |
Basel |
ZIP/Postal code |
4058 |
Country |
Switzerland |
|
|
Platform ID |
GPL17769 |
Series (1) |
GSE84589 |
Cis-regulatory landscape of four cell types of the retina |
|
Relations |
BioSample |
SAMN05417358 |
SRA |
SRX1960892 |