NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2467975 Query DataSets for GSM2467975
Status Public on Jan 26, 2017
Title IP7-treat
Sample type SRA
 
Source name bacterial cells
Organism Legionella pneumophila str. Paris
Characteristics strain: Paris
growth: exponential phase OD 2
rip antibody: monoclonal anti-FLAG MS2 #F3165 Sigma
expressing: plasmid pMMB-CsrA+2xFLAG-tag
Treatment protocol Cells were cross linked with formaldehyde (final concentration 1,1%) over night at 4°C on a rotating platform, then formaldehyde was quenched by adding 125 mM glycine and pellets were rinsed twice with PBS.
Growth protocol L. pneumophila expressing CsrA+2xFlagTag and L. pneumophila expressing CsrA without Flag-Tag as negative control were grown in AYE broth until exponential growth (OD 2).
Extracted molecule total RNA
Extraction protocol Cell pellets were resuspended in lysis buffer (50mM HEPES-KOH pH7.5, 150mM NaCl, 1mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate, protease inhibitor), sonicated and total protein concentrations were adjusted to 1mg/ml. The total protein of both samples, CsrA+2xFlagTag and negative control, was cleared separately by BSA-blocked Dynabeads protein G (Invitrogen) and subsequently incubated with Dynabeads protein G coupled to Anti-Flag antibodies (Sigma) over night at 4°C on a rotating platform. Samples and negative control were washed twice with Lysis buffer containing 350mM NaCl and 5 times with wash buffer (10mM Tris-HCl pH 7.5, 250 mM NaCl, 0.5% NP-40, 0.5% Na-deoxycholate, 1mM EDTA). Subsequently beads were washed with TE buffer, resuspended in elution buffer (50mM Tris-HCl pH 8.0, 1mM EDTA, 1% SDS) and incubated at 65°C for 30 min. Crosslinking was reversed and DNA and protein were digested to get purified RNA.
The RNA was metal-catalyzed heat fragmented to a size around 100-200nt using the RNA fragmentation kit and the RNA of both independent samples was purified and further processed according to the TruSeq stranded mRNA sample preparation guide of Illumina. The two parallel processed samples were ligated with adaptor 6 (positive CsrA+2xFlagTag library) and adaptor 12 (negative control, minus FlagTag), respectively, the quantity was determined using a Qubit 2.0 (Invitrogen) and the quality was checked using a Bioanalyzer. High quality libraries were sequenced using an Illumina HiSeq platform. This experiment was done in 5 replicates.
 
Library strategy RIP-Seq
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Data processing Basecalls performed using CASAVA version 1.8
Adapters were removed with Tagdust. We added the next adapter sequence to the default library file : TCGTATGCCGTCTTCTGCTTG
Bad quality reads extremities were trimmed using Sickle (https://github.com/najoshi/sickle). We used the Phred quality threshold 20 (-q 20). Reads shorter than 18 (IP7-9) or 15 (IP1-2) were removed.
Reads were mapped on the Legionella pneumophila strain Paris genome sequence with Bowtie 2 software
Duplicate reads were removed from mapping results with samtools rmdup, and separated BAM files for forward and reverse mapped reads were built using samtools.
For sample and control, coverage files (wig) were generated for the forward and the reverse strand and normalized according to the number of mapped base pairs. For each couple treatment/control, a scale factor was applied to scale the small sample up to the bigger sample.
Genome_build: Legionella pneumophila strain Paris, NCBI Acc.-No : NC_006368.1
Supplementary_files_format_and_content: For sample and control, coverage files (wig) were generated for the forward and the reverse strand and normalized according to the number of mapped base pairs. For each couple treatment/control, a scale factor was applied to scale the small sample up to the bigger sample. These WIG files represent the normalized coverage (in mapped reads) by position of the reference genome. There are two files (forward/reverse) for each sample (treatment or control).
 
Submission date Jan 25, 2017
Last update date May 15, 2019
Contact name Christophe Rusniok
E-mail(s) rusniok@pasteur.fr
Organization name Institut Pasteur
Department Genomes et Genetique
Lab Unite de Biologie des Bacteries Intracelulaires
Street address 25, 28 rue du Docteur Roux
City Paris
ZIP/Postal code 75015
Country France
 
Platform ID GPL22984
Series (1)
GSE94068 The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system
Relations
BioSample SAMN06270336
SRA SRX2515501

Supplementary file Size Download File type/resource
GSM2467975_IP7_nodup_forward_treat.norm.wig.gz 300.9 Kb (ftp)(http) WIG
GSM2467975_IP7_nodup_reverse_treat.norm.wig.gz 519.5 Kb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap