|
| Status |
Public on May 24, 2018 |
| Title |
STM ProQ -CL rep3 |
| Sample type |
SRA |
| |
|
| Source name |
Salmonella Typhimurium SL1344 ProQ::3xFLAG cells
|
| Organism |
Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Characteristics |
clip antibody: M2 anti-FLAG monoclonal antibody attached to superparamagnetic iron impregnated agarose beads (Sigma-Aldrich, M8823)
strain: SL1344
|
| Treatment protocol |
When the cultures reached an OD600 of 2.0, half of each culture was irradiated with UV light (254 nm, 800 mJ/cm2) while the other half was left untreated.
|
| Growth protocol |
Salmonella Thyphimurium strain SL1344 or E. coli MG1655 containing a proQ::3xflag allele was grown from single colonies in 10 ml LB medium at 37°C for 16 hours. The cultures were diluted 1:100 into 200 ml fresh LB medium and continued to grow at 37°C until an OD600 of 2.0 was reached.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Bacteria were lysed and the FLAG-tagged proteins was immunoprecipitated using a monoclonal anti-FLAG antibody. The samples were treated with benzonase nuclease, calf intestine phophorylase, and polynucleotide kinase in the presence of radioactive gamma-ATP. Samples were separated with SDS-PAGE and followed by transfer to nitrocellulose membranes. Radioactively labelled RNA-protein complexes were eluted from membranes and treated with Proteinase K. RNA was purified with phenol:chloroform extraction and ethanol precipitation.
Purified RNA was used as input for library preparation using the NEB Next Small RNA Library kit according to the manufacturer’s instructions.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
ProQ-bound RNA
background control sample
|
| Data processing |
Demultiplexing
Fastq quality trimming using FastX version 0.0.13 and a cut-off value of 20
Adapter trimming using cutadapt (Martin, 2011) version 1.5 or 1.7.1 (R1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, R2: GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT), discard empty reads
Filtering of reads without mate via cmpfastq (http://compbio.brc.iop.kcl.ac.uk/software/cmpfastq.php)
Collapsing of identical reads and conversion to FASTA format using FastUniq (Xu et al. 2012)
Size filtering: discard read pairs with at least one read longer than 25 nt
Size filtering: discard read pairs with at least one read shorter than 12 nt (READemption 0.3.7, Förstner et al., 2014)
Read mapping using segemehl version 0.2.0 (READemption 0.3.7, Förstner et al., 2014)
Coverage calculation based on uniquely mapped reads (READemption 0.3.7, Förstner et al., 2014)
Calculation of size factors by applying the DESeq normalization method (Anders et al., 2010) to non-enriched nucleotide positions from coverage files (for details see associated publication)
Final coverage calculation during peak calling via PEAKachu (https://github.com/tbischler/PEAKachu, manuscript in preparation) based on previously calculated size factors
Genome_build: Salmonella Typhimurium SL1344 chromosome (NC_016810.1) and plasmids (NC_017718.1, NC_017719.1, NC_017720.1); E. coli K12 MG1655 (NC_000913.3)
Supplementary_files_format_and_content: wiggle
|
| |
|
| Submission date |
Nov 07, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Thorsten Bischler |
| E-mail(s) |
thorsten.bischler@uni-wuerzburg.de
|
| Organization name |
University of Wuerzburg
|
| Department |
Core Unit SysMed
|
| Street address |
Josef-Schneider-Straße 2 / D15
|
| City |
Würzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL20056 |
| Series (1) |
| GSE106633 |
Global maps of ProQ binding in vivo reveal target recognition via RNA structure and stability control at mRNA 3' ends |
|
| Relations |
| BioSample |
SAMN07988861 |
| SRA |
SRX3372253 |
