 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 26, 2018 |
| Title |
an003_L |
| Sample type |
SRA |
| |
|
| Source name |
adult subventricular zone
|
| Organism |
Mus musculus |
| Characteristics |
tissue: brain
brain region: subventricular zone, SVZ
fixation: none
Sex: female
number of animals: 5
age (weeks): 13.9
mouse strain: C57BL/6N
genotype: wildtype
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
SVZs were microdissected, dissociated to single cells, debris and dead cells removed. The single-cell suspension was subjected to Drop-seq.
Drop-seq and single-cell library generation was performed as described in Alles et al., 2017, BMC Biol 15:44 (based on Macosko et al., 2015, Cell 161, 1202–1214). Drop-seq libraries were sequenced in paired-end mode on Illumina Nextseq 500 sequencers with 1% PhiX spike-in for run quality control. We used Illumina Nextseq500/550 High Output v2 kits (75 cycles). We sequenced in paired-end mode: Read 1: 20 bp (bases 1-12 cell barcode, bases 13-20 UMI); Read 2: 64 bp; Index read: 8 bp.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Drop-seq library
|
| Data processing |
basecalling using bcl2fastq v2.18.0.12 with parameters --no-lane-splitting --fastq-compression-level=9 --mask-short-adapter-reads 15
FastqToSam, from package Picard-tools v.2.9.0, with default parameters
Cell barcode to tag in 2nd read. TagBamWithReadSequenceExtended, from package Drop-seq_tools v1.12 with parameters BASE_RANGE=1-12 DISCARD_READ=false TAG_NAMES=XC COMPRESSION_LEVEL=0
UMI to tag in 2nd read and removal of first read. TagBamWithReadSequenceExtended, from package Drop-seq_tools v1.12 with parameters BASE_RANGE=13-20 DISCARD_READ=true TAG_NAMES=XM COMPRESSION_LEVEL=0
Filter sequences with low quality barcodes. FilterBAM, from package Drop-seq_tools v1.12 with parameters TAG_REJECT=XQ
Trimming SMART adapter. TrimStartingSequence, from package Drop-seq_tools v1.12, with parameters SEQUENCE=AAGCAGTGGTATCAACGCAGAGTGAATGGG MISMATCHES=0 NUM_BASES=5
Trimming polyA. PolyATrimmer, from package Drop-seq_tools v1.12 with parameters MISMATCHES=0 NUM_BASES=6
SamToFastq, from package Picard-tools v.2.9.0 with default parameters
Alignment using STAR v2.5.3a with default parameters
SortSam, from package Picard-tools v.2.9.0 with default parameters
Merge barcode tags with mapped output. MergeBamAlignment, from package Picard-tools v.2.9.0 with parameters INCLUDE_SECONDARY_ALIGNMENTS=false PAIRED_RUN=false
TagReadWithGeneExon, from package Drop-seq_tools v1.12, with annotation Mus_musculus GRCm38.p4.gtf TAG=GE CREATE_INDEX=true
DetectBeadSynthesisErrors, from package Drop-seq_tools v1.12 with parameters NUM_BARCODES=12000, PRIMER_SEQUENCE=AAGCAGTGGTATCAACGCAGAGTAC
Custom R script that calculates the inflection point of the cumulative sum of reads and returns the number of barcodes until that point. Those barcodes and include in downstream steps
DigitalExpression, from package Drop-seq_tools v1.12, This step creates the dge.txt.gz which is provided as processed data files. Parameters the output of the previous step, custom R script
Genome_build: mm10
Supplementary_files_format_and_content: All dge.txt.gz files are digital gene expression matrices. These are matrices of raw counts (rows are genes, columns are cells). Values are separated by tab.
|
| |
|
| Submission date |
Mar 07, 2018 |
| Last update date |
Nov 26, 2018 |
| Contact name |
Nikolaus Rajewsky |
| E-mail(s) |
Rajewsky@mdc-berlin.de
|
| Organization name |
MDC Berlin
|
| Department |
BIMSB
|
| Lab |
Systems Biology of Gene Regulatory Elements
|
| Street address |
Robert-Rössle-Str. 10
|
| City |
Berlin |
| ZIP/Postal code |
13092 |
| Country |
Germany |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE111527 |
Single-cell transcriptomics characterizes cell types in the subventricular zone and uncovers molecular defects impairing adult neurogenesis. |
|
| Relations |
| BioSample |
SAMN08648027 |
| SRA |
SRX3771837 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3032677_an003L_dge.txt.gz |
4.2 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
