NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3032679 Query DataSets for GSM3032679
Status Public on Nov 26, 2018
Title an009
Sample type SRA
 
Source name adult subventricular zone
Organism Mus musculus
Characteristics tissue: brain
brain region: subventricular zone, SVZ
fixation: none
Sex: mixed
number of animals: 2 female, 2 male
age (weeks): 13.4
mouse strain: C57BL/6N
genotype: wildtype
Extracted molecule polyA RNA
Extraction protocol SVZs were microdissected, dissociated to single cells, debris and dead cells removed. The single-cell suspension was subjected to Drop-seq.
Drop-seq and single-cell library generation was performed as described in Alles et al., 2017, BMC Biol 15:44 (based on Macosko et al., 2015, Cell 161, 1202–1214). Drop-seq libraries were sequenced in paired-end mode on Illumina Nextseq 500 sequencers with 1% PhiX spike-in for run quality control. We used Illumina Nextseq500/550 High Output v2 kits (75 cycles). We sequenced in paired-end mode: Read 1: 20 bp (bases 1-12 cell barcode, bases 13-20 UMI); Read 2: 64 bp; Index read: 8 bp.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description Drop-seq library
Data processing basecalling using bcl2fastq v2.18.0.12 with parameters --no-lane-splitting --fastq-compression-level=9 --mask-short-adapter-reads 15
FastqToSam, from package Picard-tools v.2.9.0, with default parameters
Cell barcode to tag in 2nd read. TagBamWithReadSequenceExtended, from package Drop-seq_tools v1.12 with parameters BASE_RANGE=1-12 DISCARD_READ=false TAG_NAMES=XC COMPRESSION_LEVEL=0
UMI to tag in 2nd read and removal of first read. TagBamWithReadSequenceExtended, from package Drop-seq_tools v1.12 with parameters BASE_RANGE=13-20 DISCARD_READ=true TAG_NAMES=XM COMPRESSION_LEVEL=0
Filter sequences with low quality barcodes. FilterBAM, from package Drop-seq_tools v1.12 with parameters TAG_REJECT=XQ
Trimming SMART adapter. TrimStartingSequence, from package Drop-seq_tools v1.12, with parameters SEQUENCE=AAGCAGTGGTATCAACGCAGAGTGAATGGG MISMATCHES=0 NUM_BASES=5
Trimming polyA. PolyATrimmer, from package Drop-seq_tools v1.12 with parameters MISMATCHES=0 NUM_BASES=6
SamToFastq, from package Picard-tools v.2.9.0 with default parameters
Alignment using STAR v2.5.3a with default parameters
SortSam, from package Picard-tools v.2.9.0 with default parameters
Merge barcode tags with mapped output. MergeBamAlignment, from package Picard-tools v.2.9.0 with parameters INCLUDE_SECONDARY_ALIGNMENTS=false PAIRED_RUN=false
TagReadWithGeneExon, from package Drop-seq_tools v1.12, with annotation Mus_musculus GRCm38.p4.gtf TAG=GE CREATE_INDEX=true
DetectBeadSynthesisErrors, from package Drop-seq_tools v1.12 with parameters NUM_BARCODES=12000, PRIMER_SEQUENCE=AAGCAGTGGTATCAACGCAGAGTAC
Custom R script that calculates the inflection point of the cumulative sum of reads and returns the number of barcodes until that point. Those barcodes and include in downstream steps
DigitalExpression, from package Drop-seq_tools v1.12, This step creates the dge.txt.gz which is provided as processed data files. Parameters the output of the previous step, custom R script
Genome_build: mm10
Supplementary_files_format_and_content: All dge.txt.gz files are digital gene expression matrices. These are matrices of raw counts (rows are genes, columns are cells). Values are separated by tab.
 
Submission date Mar 07, 2018
Last update date Nov 26, 2018
Contact name Nikolaus Rajewsky
E-mail(s) Rajewsky@mdc-berlin.de
Organization name MDC Berlin
Department BIMSB
Lab Systems Biology of Gene Regulatory Elements
Street address Robert-Rössle-Str. 10
City Berlin
ZIP/Postal code 13092
Country Germany
 
Platform ID GPL19057
Series (1)
GSE111527 Single-cell transcriptomics characterizes cell types in the subventricular zone and uncovers molecular defects impairing adult neurogenesis.
Relations
BioSample SAMN08648025
SRA SRX3771839

Supplementary file Size Download File type/resource
GSM3032679_an009_dge.txt.gz 3.1 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap