|
Status |
Public on Jan 27, 2019 |
Title |
Wild-Type hyperosmotic stress profiling 1 |
Sample type |
SRA |
|
|
Source name |
Wild-Type hyperosmotic stress profiling
|
Organism |
Saccharomyces cerevisiae |
Characteristics |
genotype/variation: Wild-Type plasmid(s): None molecule subtype: Ribosome Protected mRNA (15-34 nt)
|
Treatment protocol |
Yeast cells were harvested by vacuum filtration and flash frozen. Samples were homogenized and lysed with lysis buffer using a freezer mill.
|
Growth protocol |
Yeast cells were grown to OD ~0.5; mammalian cells were grown to ~75% confluence; Synchronized L1 worms were plated on HT115 bacteria transformed with pL4440 vector and cultured at 25˚C for ~48 hours.
|
Extracted molecule |
total RNA |
Extraction protocol |
Lysates were clarified and monosomes were isolated by sucrose gradient centrifugation after RNaseI treatment. RNA was extracted using SDS/hot phenol/chloroform. Fragments ranging from 15-34 nt were gel purified and rRNA was depleted from this pool through Ribo-Zero Gold treatment. Upon dephosphorylation of sample RNA, linker was ligated and this product was once again gel purified. This was followed by reverse transcription as well as circularization of cDNAs. PCR amplification of this library was then sent for sequencing.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
processed data file: CHXTIG_21ntRPF_occupancy.csv wtOSM1
|
Data processing |
Base calling was performed at Johns Hopkins core facilities with CASAVA 1.8 Adapter sequence (NNNNNNCACTCGGGCACCAAGGA) removed with Skewer 4 random nucleotides included in RT primer (RNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/TTCAGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG) were removed from the 5’ end of reads. Trimmed reads longer than 15 nt were aligned to yeast ribosomal and non-coding RNA sequences using STAR with ‘--outFilterMismatchNoverLmax 0.3’. Unmapped reads were then mapped to genome using the following options ‘--outFilterIntronMotifs RemoveNoncanonicalUnannotated --outFilterMultimapNmax 1 --outFilterMismatchNoverLmax 0.1’. Genome_build: SacCer3 R64-1-1, Ce10, hg19 Supplementary_files_format_and_content: Count tables for relative codon occupancies or fixed-step WIG density files for mapped reads
|
|
|
Submission date |
May 31, 2018 |
Last update date |
Jan 27, 2019 |
Contact name |
Colin Wu |
Organization name |
NCI
|
Department |
RNA Biology Laboratory
|
Street address |
1050 Boyles St, BG 560, RM21-102C
|
City |
Frederick |
State/province |
MD |
ZIP/Postal code |
21702 |
Country |
USA |
|
|
Platform ID |
GPL17342 |
Series (2) |
GSE115161 |
Regulation of Translation Elongation Revealed by Ribosome Profiling [Dataset_4] |
GSE115162 |
Regulation of Translation Elongation Revealed by Ribosome Profiling |
|
Relations |
BioSample |
SAMN09288706 |
SRA |
SRX4147703 |