|
| Status |
Public on Feb 18, 2020 |
| Title |
NM ProQ FLAG +crosslink replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
Neisseria meninigitidis 8013 ProQ::3xFLAG cells
|
| Organism |
Neisseria meningitidis 8013 |
| Characteristics |
clip antibody: M2 anti-FLAG monoclonal antibody attached to superparamagnetic iron impregnated agarose beads (Sigma-Aldrich, M8823)
strain: NM8013
fraction: ProQ-bound RNA
|
| Treatment protocol |
When the cultures reached an OD600 of 2.0, half of each culture was irradiated with UV light (254 nm, 800 mJ/cm2) while the other half was left untreated.
|
| Growth protocol |
Neisseria meninigitidis strain 8013 containing a proQ::3xflag allele grown as solid culture overnight was harvested and a starter culture was inoculated to a final optical density (OD600nm) of 1.0 in 5 ml GCB-liquid medium supplemented with Kellogg’s supplement I and II (GCBL++) in 50ml Falcon-tubes. After one hour the starter culture was used to inoculate GCBL++ medium to a final OD600nm of 0.15. Bacteria were grown in 100 ml Falcon-tubes at 37 °C at 220 rpm without added CO2 until an OD600 of 2.0 was reached.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Bacteria were lysed and the FLAG-tagged proteins was immunoprecipitated using a monoclonal anti-FLAG antibody. The samples were treated with benzonase nuclease, calf intestine phophorylase, and polynucleotide kinase in the presence of radioactive gamma-ATP. Samples were separated with SDS-PAGE and followed by transfer to nitrocellulose membranes. Radioactively labelled RNA-protein complexes were eluted from membranes and treated with Proteinase K. RNA was purified with phenol:chloroform extraction and ethanol precipitation.
Purified RNA was used as input for library preparation using the NEB Next Small RNA Library kit according to the manufacturer’s instructions.
Purified RNA was used as input for library preparation using the NEB Next Small RNA Library kit according to the manufacturer’s instructions.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
signal sample
|
| Data processing |
Quality trimming: FASTX 0.0.13 fastq_quality_trimmer, Phred cut-off of 20
Adapter trimming using cutadapt (Martin, 2011) version 1.7.1 (R1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, R2: GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT), discard empty reads
Filtering of reads without mate via cmpfastq (http://compbio.brc.iop.kcl.ac.uk/software/cmpfastq.php)
Collapsing of identical reads and conversion to FASTA format using FastUniq (Xu et al. 2012)
Read mapping using segemehl version 0.2.0 with minimum accuracy 80% (READemption 0.3.7, Förstner et al., 2014)
Coverage calculation based on uniquely mapped reads (READemption 0.3.7, Förstner et al., 2014)
Calculation of size factors by applying the DESeq normalization method (Anders et al., 2010) to non-enriched nucleotide positions from coverage files (for details see associated publication)
Final coverage calculation during peak calling via PEAKachu (https://github.com/tbischler/PEAKachu, manuscript in preparation) based on previously calculated size factors
Genome_build: Neisseria meningitidis 8013 (Assembly acc.: GCF_000026965.1, Sequence ID: NC_017501.1 )
Supplementary_files_format_and_content: wiggle
|
| |
|
| Submission date |
Apr 16, 2019 |
| Last update date |
Feb 18, 2020 |
| Contact name |
Thorsten Bischler |
| E-mail(s) |
thorsten.bischler@uni-wuerzburg.de
|
| Organization name |
University of Wuerzburg
|
| Department |
Core Unit SysMed
|
| Street address |
Josef-Schneider-Straße 2 / D15
|
| City |
Würzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL24628 |
| Series (2) |
| GSE129866 |
The minimal ProQ protein of Neisseria meningitidis is a global RNA-binding protein that operates in parallel with Hfq [CLIP-Seq] |
| GSE129868 |
The minimal ProQ protein of Neisseria meningitidis is a global RNA-binding protein that operates in parallel with Hfq |
|
| Relations |
| BioSample |
SAMN11433251 |
| SRA |
SRX5692999 |
