|
| Status |
Public on Feb 18, 2020 |
| Title |
NM8013 wt R3 |
| Sample type |
SRA |
| |
|
| Source name |
Neisseria meninigitidis 8013 wt
|
| Organism |
Neisseria meningitidis 8013 |
| Characteristics |
strain: NM8013
genotype: wild type
|
| Treatment protocol |
When the cultures reached an OD600nm of 2.0, bacteria were snapfrozen inliquid nitrogen prior to total RNA extraction with the hot phenol method. Wild-type and proQ deletion samples were treated equally.
|
| Growth protocol |
Neisseria meninigitidis strains 8013 wild-type and proQ deletion grown on solid media overnight were harvested and starter cultures were inoculated to a final optical density (OD600nm) of 1.0 in 5 ml GCB-liquid medium supplemented with Kellogg’s supplement I and II (GCBL++) in 50ml Falcon-tubes. After one hour the starter cultures were used to inoculate GCBL++ medium to a final OD600nm of 0.15. Bacteria were grown in 50 ml Falcon-tubes at 37 °C at 220 rpm without added CO2 until an OD600nm of 2.0 was reached.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA extraction with the hot phenol method. cDNA libraries of RNA-seq-samples were constructed by Vertis Biotechnology AG, Munich, Germany. To deplete ribosomal transcripts, RNA-seq samples were treated with the Ribo-Zero “Bacteria” kit (Illumina) followed by RNA fragmentation and adapter ligation. cDNA libraries of RNA-seq samples were pooled on an Illumina NextSeq 500 high‐output flow cell and sequenced in single-read mode (1x76 cycles).
cDNA libraries of RNA-seq-samples were constructed by Vertis Biotechnology AG, Munich, Germany. To deplete ribosomal transcripts, RNA-seq samples were treated with the Ribo-Zero “Bacteria” kit (Illumina) followed by RNA fragmentation and adapter ligation.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Demutliplexing via bcl2fastq v2.20.0.422
Fastq quality and adapter trimming using cutadapt (Martin, 2011) version 1.16 (Command line parameters: --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)
Size filtering: discard read pairs with at least one read shorter than 12 nt (READemption 0.4.5, Förstner et al., 2014)
Read mapping using segemehl version 0.2.0 with minimum accuracy 95% (READemption 0.4.5, Förstner et al., 2014)
Coverage calculation based on all aligned reads (full-length); Normalization: coverage-tnoar_min_normalized (counts divided by total number of aligned reads and multiplied by minimum over all libraries) (READemption 0.4.5, Förstner et al., 2014)
Genome_build: Neisseria meningitidis 8013 (Assembly acc.: GCF_000026965.1, Sequence ID: NC_017501.1 )
Supplementary_files_format_and_content: wiggle
|
| |
|
| Submission date |
Apr 16, 2019 |
| Last update date |
Feb 18, 2020 |
| Contact name |
Thorsten Bischler |
| E-mail(s) |
thorsten.bischler@uni-wuerzburg.de
|
| Organization name |
University of Wuerzburg
|
| Department |
Core Unit SysMed
|
| Street address |
Josef-Schneider-Straße 2 / D15
|
| City |
Würzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL24628 |
| Series (2) |
| GSE129867 |
The minimal ProQ protein of Neisseria meningitidis is a global RNA-binding protein that operates in parallel with Hfq [RNA-Seq] |
| GSE129868 |
The minimal ProQ protein of Neisseria meningitidis is a global RNA-binding protein that operates in parallel with Hfq |
|
| Relations |
| BioSample |
SAMN11433245 |
| SRA |
SRX5693005 |
