 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 09, 2019 |
| Title |
GoldCLIP_dNxf2Halo_mael_KD_CLIP_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
OSC
|
| Organism |
Drosophila melanogaster |
| Characteristics |
strain: OSC
genotype: mael KD
clip antibody: Halo-ligand
|
| Treatment protocol |
The DNA templates containing T7 promoters were in vitro transcribed as described (Chamberlin M et al.,1970 Nature). The purified Maelstrom and LacZ dsRNAs were co-transfected with plasmids overexpressing RFP-Dicer2 into dNxf2-Halo OSCs using FuGeneHD for 3 days. CLIP was performed as descried (Gu et al., 2018 GPB, Nostrand et al., 2016, Nature Methods).
|
| Growth protocol |
OSC cells were maintained at 25 °C in Shields and Sang M3 Insect media (Sigma) supplemented with 10% fetal bovine serum (PAN-Seratech, Eden Bach, DE), 10 mg/ml insulin, 0.6 mg/ml glutathione and 5% fly extract.
|
| Extracted molecule |
other |
| Extraction protocol |
Lysates were lysed in PBS supplemented with 0.2% Triton, dounced 30 times, clarified from debri, and HaloTag-protein-RNA complexes were isolated using HaloTag Beads.
Briefly, RNA in the Halo-RBP-RNA complex was released and reverse transcribed. Then cDNAs were gel purified and amplified by PCR to add Illumina adaptors. The final libraries were purified and sequenced on Illumina X Ten platform.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Basecalls were performed using bcl2fastq v1.8.4 for Illumina HiSeq X Ten output.
CLIP-seq reads (read1 for paired-end reads) were processed using Cutadapt (v1.16) . The adapter sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and low-quality bases were trimmed from the 3’ end of reads, and reads short than 15 nt were discarded. After adapter removal, reads were collapsed, the first 10 bases were trimmed (the 5' end linkers contains 10 random nucleotides).
The processed CLIP-seq reads were aligned to fruitfly dm3 and spike-in genome (hg19, UCSC) using Bowtie v1.1.2, only uniquely mapped reads were retained for futther analysis.
Genome_build: dm3
Supplementary_files_format_and_content: bigWig files
|
| |
|
| Submission date |
Apr 18, 2019 |
| Last update date |
Aug 10, 2019 |
| Contact name |
Ming Wang |
| E-mail(s) |
wangming@ibp.ac.cn
|
| Phone |
01064881022
|
| Organization name |
Institute of Biophysics, Chinese Academy of Sciences
|
| Department |
Key Laboratory of RNA Biology
|
| Lab |
Yang Yu
|
| Street address |
#15 Datun Road, Chaoyang, Beijing 100101, China
|
| City |
Beijing |
| State/province |
Beijing |
| ZIP/Postal code |
100101 |
| Country |
China |
| |
|
| Platform ID |
GPL23702 |
| Series (2) |
| GSE130041 |
A Pandas complex adapted for piRNA-guided transposon silencing (CLIP-seq) |
| GSE130042 |
A Pandas complex adapted for piRNA-guided transposon silencing and heterochromatin formation |
|
| Relations |
| BioSample |
SAMN11463447 |
| SRA |
SRX5709948 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3730722_GoldCLIP_dNxf2Halo_mael_KD_CLIP_rep2.te.fwd.bigWig |
51.7 Kb |
(ftp)(http) |
BIGWIG |
| GSM3730722_GoldCLIP_dNxf2Halo_mael_KD_CLIP_rep2.te.rev.bigWig |
24.9 Kb |
(ftp)(http) |
BIGWIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
